Transcript: Mouse XM_006515054.1

PREDICTED: Mus musculus tribbles pseudokinase 2 (Trib2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trib2 (217410)
Length:
4108
CDS:
1194..2225

Additional Resources:

NCBI RefSeq record:
XM_006515054.1
NBCI Gene record:
Trib2 (217410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024217 GCGTTTCTTGCATCGGGAAAT pLKO.1 1363 CDS 100% 10.800 15.120 N Trib2 n/a
2 TRCN0000024216 CGGAAATTTATCTTCAAGGAT pLKO.1 1728 CDS 100% 3.000 4.200 N Trib2 n/a
3 TRCN0000362066 GACCTCAAGCTGCGGAAATTT pLKO_005 1716 CDS 100% 15.000 10.500 N Trib2 n/a
4 TRCN0000362058 GCATTGCACTGTTAGCATTTA pLKO_005 2583 3UTR 100% 13.200 9.240 N Trib2 n/a
5 TRCN0000361999 TTCGAAGAGCTGTCGTCTATA pLKO_005 1263 CDS 100% 13.200 9.240 N Trib2 n/a
6 TRCN0000024218 AGTGTCTCAAATTCGGGATTT pLKO.1 2130 CDS 100% 10.800 7.560 N Trib2 n/a
7 TRCN0000024214 CCATAGCAACATCAACCAAAT pLKO.1 1520 CDS 100% 10.800 7.560 N Trib2 n/a
8 TRCN0000024215 CGTTACCCTTTCCATGACATT pLKO.1 1944 CDS 100% 4.950 3.465 N Trib2 n/a
9 TRCN0000199912 GACCTCAAGCTGCGGAAATTC pLKO.1 1716 CDS 100% 13.200 9.240 N TRIB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03041 pDONR223 100% 91.6% 98.2% None (many diffs) n/a
2 ccsbBroad304_03041 pLX_304 0% 91.6% 98.2% V5 (many diffs) n/a
3 TRCN0000473109 GAAAACAGTATACCGCTGCCGACG pLX_317 47.5% 91.6% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_15048 pDONR223 0% 91.6% 98.2% None (many diffs) n/a
5 ccsbBroad304_15048 pLX_304 0% 91.6% 98.2% V5 (many diffs) n/a
6 TRCN0000470263 GTATACCTCTGACCACTGATTAGC pLX_317 35.1% 91.6% 98.2% V5 (many diffs) n/a
7 TRCN0000488723 TGCACACGGGTTATTCTTGGCGTG pLX_317 34.8% 91.6% 98.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV