Construct: ORF TRCN0000470315
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007916.1_s317c1
- Derived from:
- ccsbBroadEn_03409
- DNA Barcode:
- TCCCGTAACAGCCAACAAAGTTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GDAP1 (54332)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470315
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_001040875.3 | 100% | 100% | |
| 2 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_001362929.1 | 85.8% | 85.8% | 0_1ins123 |
| 3 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_001362932.1 | 85.8% | 85.8% | 0_1ins123 |
| 4 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_018972.4 | 81% | 81% | 1_204del |
| 5 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_001362930.1 | 64.8% | 64.5% | 1_204del;310_311ins174 |
| 6 | human | 54332 | GDAP1 | ganglioside induced differe... | NM_001362931.2 | 51% | 46.3% | (many diffs) |
| 7 | human | 54332 | GDAP1 | ganglioside induced differe... | XM_017013586.2 | 40.8% | 36.9% | (many diffs) |
| 8 | mouse | 14545 | Gdap1 | ganglioside-induced differe... | NM_010267.3 | 74.6% | 77.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg tttgaactca actggagaag tgcctgtcct tatccacggg gaaaacataa 121 tttgtgaggc cactcagatc attgattatc ttgaacagac tttcctggat gaaagaacac 181 ccaggttaat gcctgataaa gaaagcatgt attacccacg ggtacaacat taccgagagc 241 tgcttgactc cttgccaatg gatgcctata cacatggctg cattttacat cctgagttaa 301 ctgtggactc catgatcccg gcttatgcaa ctacaaggat tcgtagccaa attggaaaca 361 cagagtctga gctgaagaaa cttgctgaag aaaacccaga tttacaagaa gcatacattg 421 caaaacagaa acgacttaaa tcaaagctgc ttgatcatga caatgtcaag tatttgaaga 481 aaattcttga tgagttggag aaagtcttgg atcaggttga aactgaattg caaagaagaa 541 atgaagaaac cccagaagag ggccagcaac cttGGCTCTG CGGTGAATCC TTCACCCTGG 601 CAGACGTCTC ACTCGCTGTC ACATTGCATC GACTGAAGTT CCTGGGGTTT GCAAGGAGAA 661 ACTGGGGAAA CGGAAAGCGA CCAAACTTGG AAACCTATTA CGAGCGTGTC TTGAAGAGAA 721 AAACATTTAA CAAGGTTTTA GGACATGTCA ACAATATATT AATCTCTGCA GTGCTGCCAA 781 CAGCATTCCG GGTGGCCAAG AAAAGGGCCC CAAAAGTTCT TGGCACGACC CTTGTGGTTG 841 GTTTGCTTGC AGGAGTGGGA TATTTTGCTT TTATGCTTTT CAGAAAGAGG CTTGGCAGCA 901 TGATATTAGC ATTTAGACCC AGACCAAATT ATTTCTACCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ATCCCGTAAC AGCCAACAAA GTTTAACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt