Transcript: Human NM_018972.4

Homo sapiens ganglioside induced differentiation associated protein 1 (GDAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GDAP1 (54332)
Length:
3645
CDS:
60..1136

Additional Resources:

NCBI RefSeq record:
NM_018972.4
NBCI Gene record:
GDAP1 (54332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118969 GCCACTCAGATCATTGATTAT pLKO.1 327 CDS 100% 13.200 18.480 N GDAP1 n/a
2 TRCN0000174794 GCCACTCAGATCATTGATTAT pLKO.1 327 CDS 100% 13.200 18.480 N Gdap1 n/a
3 TRCN0000118968 CGACCAAACTTGGAAACCTAT pLKO.1 876 CDS 100% 4.950 6.930 N GDAP1 n/a
4 TRCN0000129713 CGACTTAAATCAAAGCTGCTT pLKO.1 630 CDS 100% 2.640 2.112 N GDAP1 n/a
5 TRCN0000118967 CCCAGGTTAATGCCTGATAAA pLKO.1 378 CDS 100% 13.200 9.240 N GDAP1 n/a
6 TRCN0000130035 GACCAAACTTGGAAACCTATT pLKO.1 877 CDS 100% 10.800 7.560 N GDAP1 n/a
7 TRCN0000131194 GAGCACAATGAGCCTTGGTTT pLKO.1 243 CDS 100% 4.950 3.465 N GDAP1 n/a
8 TRCN0000118971 GCCTATACACATGGCTGCATT pLKO.1 462 CDS 100% 4.950 3.465 N GDAP1 n/a
9 TRCN0000130048 GCCTGATAAAGAAAGCATGTA pLKO.1 389 CDS 100% 4.950 3.465 N GDAP1 n/a
10 TRCN0000118970 CTTAAATCAAAGCTGCTTGAT pLKO.1 633 CDS 100% 0.495 0.347 N GDAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03409 pDONR223 100% 81% 81% None 1_204del n/a
2 ccsbBroad304_03409 pLX_304 0% 81% 81% V5 1_204del n/a
3 TRCN0000470315 TCCCGTAACAGCCAACAAAGTTTA pLX_317 41.9% 81% 81% V5 1_204del n/a
Download CSV