Transcript: Human NM_001362929.1

Homo sapiens ganglioside induced differentiation associated protein 1 (GDAP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GDAP1 (54332)
Length:
3534
CDS:
262..1011

Additional Resources:

NCBI RefSeq record:
NM_001362929.1
NBCI Gene record:
GDAP1 (54332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118968 CGACCAAACTTGGAAACCTAT pLKO.1 751 CDS 100% 4.950 6.930 N GDAP1 n/a
2 TRCN0000129713 CGACTTAAATCAAAGCTGCTT pLKO.1 505 CDS 100% 2.640 2.112 N GDAP1 n/a
3 TRCN0000118967 CCCAGGTTAATGCCTGATAAA pLKO.1 253 5UTR 100% 13.200 9.240 N GDAP1 n/a
4 TRCN0000130035 GACCAAACTTGGAAACCTATT pLKO.1 752 CDS 100% 10.800 7.560 N GDAP1 n/a
5 TRCN0000118971 GCCTATACACATGGCTGCATT pLKO.1 337 CDS 100% 4.950 3.465 N GDAP1 n/a
6 TRCN0000130048 GCCTGATAAAGAAAGCATGTA pLKO.1 264 CDS 100% 4.950 3.465 N GDAP1 n/a
7 TRCN0000118970 CTTAAATCAAAGCTGCTTGAT pLKO.1 508 CDS 100% 0.495 0.347 N GDAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03409 pDONR223 100% 85.8% 85.8% None 0_1ins123 n/a
2 ccsbBroad304_03409 pLX_304 0% 85.8% 85.8% V5 0_1ins123 n/a
3 TRCN0000470315 TCCCGTAACAGCCAACAAAGTTTA pLX_317 41.9% 85.8% 85.8% V5 0_1ins123 n/a
Download CSV