Construct: ORF TRCN0000470411
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005394.1_s317c1
- Derived from:
- ccsbBroadEn_00974
- DNA Barcode:
- GAATTTTCATTATTTTCAAGAAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAS1 (4142)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470411
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4142 | MAS1 | MAS1 proto-oncogene, G prot... | NM_001366704.1 | 100% | 100% | |
| 2 | human | 4142 | MAS1 | MAS1 proto-oncogene, G prot... | NM_002377.4 | 100% | 100% | |
| 3 | mouse | 17171 | Mas1 | MAS1 oncogene | NM_008552.5 | 85.3% | 90.1% | (many diffs) |
| 4 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_006523293.4 | 85.3% | 90.1% | (many diffs) |
| 5 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_006523294.4 | 85.3% | 90.1% | (many diffs) |
| 6 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_006523296.4 | 85.3% | 90.1% | (many diffs) |
| 7 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_011246190.3 | 85.3% | 90.1% | (many diffs) |
| 8 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_011246191.3 | 85.3% | 90.1% | (many diffs) |
| 9 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_011246192.3 | 85.3% | 90.1% | (many diffs) |
| 10 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_011246193.3 | 85.3% | 90.1% | (many diffs) |
| 11 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_017317270.2 | 85.3% | 90.1% | (many diffs) |
| 12 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_030249523.1 | 85.3% | 90.1% | (many diffs) |
| 13 | mouse | 17171 | Mas1 | MAS1 oncogene | XM_030249524.1 | 85.3% | 90.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tgggtcaaac gtgacatcat ttgttgttga ggaacccacg aacatctcaa 121 ctggcaggaa cgcctcagtc gggaatgcac atcggcaaat ccccatcgtg cactgggtca 181 ttatgagcat ctccccagtg gggtttgttg agaatgggat tctcctctgg ttcctgtgct 241 tccggatgag aagaaatccc ttcactgtct acatcaccca cctgtctatc gcagacatct 301 cactgctctt ctgtattttc atcttgtcta tcgactatgc tttagattat gagctttctt 361 ctggccatta ctacacaatt gtcacattat cagtgacttt tctgtttggc tacaacacgg 421 gcctctatct gctgacggcc attagtgtgg agaggtgcct gtcagtcctt taccccatct 481 ggtaccgatg ccatcgcccc aagtaccagt cggcattggt ctgtgccctt ctgtgggctc 541 tttcttgctt ggtgaccacc atggagtatg tcatgtgcat cgacagagaa gaagagagtc 601 actctcggaa tgactgccga gcagtcatca tctttatagc catcctgagc ttccTGGTCT 661 TCACGCCCCT CATGCTGGTG TCCAGCACCA TCTTGGTCGT GAAGATCCGG AAGAACACGT 721 GGGCTTCCCA TTCCTCCAAG CTTTACATAG TCATCATGGT CACCATCATT ATATTCCTCA 781 TCTTCGCTAT GCCCATGAGA CTCCTTTACC TGCTGTACTA TGAGTATTGG TCGACCTTTG 841 GGAACCTACA CCACATTTCC CTGCTCTTCT CCACAATCAA CAGTAGCGCC AACCCTTTCA 901 TTTACTTCTT TGTGGGAAGC AGTAAGAAGA AGAGATTCAA GGAGTCCTTA AAAGTTGTTC 961 TGACCAGGGC TTTCAAAGAT GAAATGCAAC CTCGGCGCCA GAAAGACAAT TGTAATACGG 1021 TCACAGTTGA GACTGTCGTC TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGAAT TTTCATTATT 1201 TTCAAGAAAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt