Transcript: Mouse XM_017317270.2

PREDICTED: Mus musculus MAS1 oncogene (Mas1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mas1 (17171)
Length:
3087
CDS:
1420..2394

Additional Resources:

NCBI RefSeq record:
XM_017317270.2
NBCI Gene record:
Mas1 (17171)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240391 CACTACACAATCGTGACATTA pLKO_005 1720 CDS 100% 13.200 18.480 N LOC100048871 n/a
2 TRCN0000240393 GCGCTTCAGGGAGTCCTTAAA pLKO_005 2283 CDS 100% 13.200 18.480 N LOC100048871 n/a
3 TRCN0000222343 CGGTCTACATTACCCACTTGT pLKO.1 1616 CDS 100% 4.950 6.930 N Mas1 n/a
4 TRCN0000222339 CGTGACATTATCGGTGACTTT pLKO.1 1731 CDS 100% 4.950 6.930 N Mas1 n/a
5 TRCN0000222342 CTGCATAACATCTCCTTGCTT pLKO.1 2197 CDS 100% 3.000 4.200 N Mas1 n/a
6 TRCN0000240395 TGATCAACAGTGAACTATAAA pLKO_005 2629 3UTR 100% 15.000 10.500 N LOC100048871 n/a
7 TRCN0000240394 CCACTTGTCCATTGCTGATAT pLKO_005 1629 CDS 100% 13.200 9.240 N LOC100048871 n/a
8 TRCN0000240392 GTCATCATGGTCACCATTATC pLKO_005 2101 CDS 100% 13.200 9.240 N LOC100048871 n/a
9 TRCN0000222340 CCTGTCCATTGACTATGCTTT pLKO.1 1674 CDS 100% 4.950 3.465 N Mas1 n/a
10 TRCN0000222341 CCAGGGCTTTCAAAGATGAAA pLKO.1 2315 CDS 100% 0.563 0.338 N Mas1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15493 pDONR223 0% 85.3% 90.1% None (many diffs) n/a
2 ccsbBroad304_15493 pLX_304 0% 85.3% 90.1% V5 (many diffs) n/a
3 TRCN0000468803 AGTAGGTACAACATGCGTTGTATC pLX_317 40.6% 85.3% 90.1% V5 (many diffs) n/a
4 ccsbBroadEn_00974 pDONR223 100% 85.3% 90.1% None (many diffs) n/a
5 ccsbBroad304_00974 pLX_304 0% 85.3% 90.1% V5 (many diffs) n/a
6 TRCN0000470411 GAATTTTCATTATTTTCAAGAAAG pLX_317 39.8% 85.3% 90.1% V5 (many diffs) n/a
7 TRCN0000492089 CCGACCACGACAGTCAATCGCGTG pLX_317 40.7% 85.3% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488234 GTAGGTGCAAACGCGAGACAGACC pLX_317 31.9% 85.2% 89.8% V5 (many diffs) n/a
Download CSV