Transcript: Human NM_001366704.1

Homo sapiens MAS1 proto-oncogene, G protein-coupled receptor (MAS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MAS1 (4142)
Length:
2279
CDS:
233..1210

Additional Resources:

NCBI RefSeq record:
NM_001366704.1
NBCI Gene record:
MAS1 (4142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357604 TCGACTATGCTTTAGATTATG pLKO_005 498 CDS 100% 13.200 18.480 N MAS1 n/a
2 TRCN0000357605 CGGGAATGCACATCGGCAAAT pLKO_005 307 CDS 100% 10.800 15.120 N MAS1 n/a
3 TRCN0000011733 CTATCGACTATGCTTTAGATT pLKO.1 495 CDS 100% 5.625 7.875 N MAS1 n/a
4 TRCN0000222341 CCAGGGCTTTCAAAGATGAAA pLKO.1 1131 CDS 100% 0.563 0.450 N Mas1 n/a
5 TRCN0000357603 CATCGTGCACTGGGTCATTAT pLKO_005 331 CDS 100% 13.200 9.240 N MAS1 n/a
6 TRCN0000357533 CTATCTGCTGACGGCCATTAG pLKO_005 592 CDS 100% 10.800 7.560 N MAS1 n/a
7 TRCN0000011736 CAGTAAGAAGAAGAGATTCAA pLKO.1 1087 CDS 100% 5.625 3.938 N MAS1 n/a
8 TRCN0000011734 GCGCCAGAAAGACAATTGTAA pLKO.1 1162 CDS 100% 5.625 3.938 N MAS1 n/a
9 TRCN0000011735 TGTCACATTATCAGTGACTTT pLKO.1 547 CDS 100% 0.495 0.347 N MAS1 n/a
10 TRCN0000011732 GCCGAGCAGTCATCATCTTTA pLKO.1 783 CDS 100% 13.200 7.920 N MAS1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1787 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00974 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00974 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470411 GAATTTTCATTATTTTCAAGAAAG pLX_317 39.8% 100% 100% V5 n/a
4 TRCN0000492089 CCGACCACGACAGTCAATCGCGTG pLX_317 40.7% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000488234 GTAGGTGCAAACGCGAGACAGACC pLX_317 31.9% 99.8% 99.6% V5 975_976insG n/a
6 ccsbBroadEn_15493 pDONR223 0% 99.8% 100% None 633C>T n/a
7 ccsbBroad304_15493 pLX_304 0% 99.8% 100% V5 633C>T n/a
8 TRCN0000468803 AGTAGGTACAACATGCGTTGTATC pLX_317 40.6% 99.8% 100% V5 633C>T n/a
Download CSV