Construct: ORF TRCN0000470413
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011146.1_s317c1
- Derived from:
- ccsbBroadEn_03904
- DNA Barcode:
- TTTTACGGCTAGGGGCCCAAACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAM204A (63877)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470413
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63877 | FAM204A | family with sequence simila... | NM_001134672.2 | 100% | 100% | |
| 2 | human | 63877 | FAM204A | family with sequence simila... | NM_022063.3 | 100% | 100% | |
| 3 | human | 63877 | FAM204A | family with sequence simila... | XM_005270024.1 | 97% | 97% | 1_21del |
| 4 | human | 63877 | FAM204A | family with sequence simila... | XR_945795.1 | 11.9% | 1_59del;601_707del;866_5836del | |
| 5 | human | 63877 | FAM204A | family with sequence simila... | XR_001747176.2 | 11.5% | 1_265del;807_913del;1072_6042del | |
| 6 | human | 63877 | FAM204A | family with sequence simila... | XR_001747175.1 | 11.2% | 1_444del;986_1092del;1251_6221del | |
| 7 | mouse | 76539 | Fam204a | family with sequence simila... | NM_029648.6 | 83.6% | 78.8% | (many diffs) |
| 8 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527443.3 | 83.6% | 78.8% | (many diffs) |
| 9 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527444.3 | 83.6% | 78.8% | (many diffs) |
| 10 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527445.3 | 83.6% | 78.8% | (many diffs) |
| 11 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527446.3 | 83.6% | 78.8% | (many diffs) |
| 12 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527447.2 | 83.6% | 78.8% | (many diffs) |
| 13 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527448.2 | 49.2% | 48.9% | (many diffs) |
| 14 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527449.2 | 49.2% | 48.9% | (many diffs) |
| 15 | mouse | 76539 | Fam204a | family with sequence simila... | XM_006527450.2 | 49.2% | 48.9% | (many diffs) |
| 16 | mouse | 76539 | Fam204a | family with sequence simila... | XM_017318307.1 | 49.2% | 48.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 765
- ORF length:
- 699
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gagtgggctg ctacctcctg gcctaaatga aagtgacgct gagtcaaact 121 cggaagatga agctacgttg gagaactctg gacttaactt acaggaagat aaagaggatg 181 agagcatcag aaaaacagaa atcatagatt tctcaacaga tgaaccaaaa actgaaacag 241 agtcaaatgt aaatgcctat gaagagtgtc cttctggaat tcccatagat atgtggaata 301 aatttcaaga attgcataaa aaacattctg aacagaaaag cacaacctca agattcagag 361 ggaaaagaag aaaacgctcc agaaaagata aattgaagaa tgaaaaagaa ttacatagtg 421 aaccgtcctc aaatgaaacc cagtggaaag agcttactca gtattttGGA GTCAATGATA 481 GATTTGACCC GCCTGTTAAA AGGAAAAAAG TTGAGAAGTC AGGCCTTGAA AAGAGGATAG 541 ACCAGGCTGT GGAGGAGTGG AATATTGAGA AGGCTGAGGA ACTCAGCAAC CAGCTAGCTA 601 CTCGAGAGCT TGGTGTAAAA ATTGCCAAAG CAGTTGCCTG CCACAACTTT GTAAAAGCCA 661 AAAAGGAGGT TGAAAATTCA CAGGCTGCCC GAAAAAAGAA GAAACTTGCA TGGGGGTTTG 721 AAGCAAAGAA GAGATGGGAA ACCAAAAGCA ACATGGGATA CATGTACCCA ACTTTCTTGT 781 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 841 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 901 GAAAGGACGA TTTTACGGCT AGGGGCCCAA ACTTACGCGT TAAGTCgaca atcaacctct 961 ggattacaaa atttgtgaaa gatt