Transcript: Human NM_022063.3

Homo sapiens family with sequence similarity 204 member A (FAM204A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM204A (63877)
Length:
13898
CDS:
265..966

Additional Resources:

NCBI RefSeq record:
NM_022063.3
NBCI Gene record:
FAM204A (63877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129386 GCTGAGTCAAACTCGGAAGAT pLKO.1 307 CDS 100% 4.950 6.930 N FAM204A n/a
2 TRCN0000129431 GATAGATTTGACCCGCCTGTT pLKO.1 676 CDS 100% 4.050 5.670 N FAM204A n/a
3 TRCN0000364724 CCCATAGATATGTGGAATAAA pLKO_005 481 CDS 100% 15.000 10.500 N FAM204A n/a
4 TRCN0000364791 TAGACTCAAATGCTCAATTTA pLKO_005 993 3UTR 100% 15.000 10.500 N FAM204A n/a
5 TRCN0000364790 GTTGGAGAACTCTGGACTTAA pLKO_005 336 CDS 100% 13.200 9.240 N FAM204A n/a
6 TRCN0000369544 TTTGGCGCTTTCCATTCATTT pLKO_005 1259 3UTR 100% 13.200 9.240 N FAM204A n/a
7 TRCN0000369473 TAGTGAACCGTCCTCAAATGA pLKO_005 615 CDS 100% 5.625 3.938 N FAM204A n/a
8 TRCN0000369474 TCAAATGTAAATGCCTATGAA pLKO_005 442 CDS 100% 5.625 3.938 N FAM204A n/a
9 TRCN0000128785 CAAACTCGGAAGATGAAGCTA pLKO.1 314 CDS 100% 3.000 2.100 N FAM204A n/a
10 TRCN0000129004 GAAGCAAAGAAGAGATGGGAA pLKO.1 919 CDS 100% 2.640 1.848 N FAM204A n/a
11 TRCN0000130324 GAATATTGAGAAGGCTGAGGA pLKO.1 759 CDS 100% 2.640 1.848 N FAM204A n/a
12 TRCN0000130255 CCTAAATGAAAGTGACGCTGA pLKO.1 291 CDS 100% 2.160 1.512 N FAM204A n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8249 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8249 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03904 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03904 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470413 TTTTACGGCTAGGGGCCCAAACTT pLX_317 42.8% 100% 100% V5 n/a
Download CSV