Transcript: Mouse XM_006527448.2

PREDICTED: Mus musculus family with sequence similarity 204, member A (Fam204a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam204a (76539)
Length:
2119
CDS:
974..1360

Additional Resources:

NCBI RefSeq record:
XM_006527448.2
NBCI Gene record:
Fam204a (76539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175688 GCCTGCCACAAGTTTGTTAAA pLKO.1 1229 CDS 100% 13.200 18.480 N Fam204a n/a
2 TRCN0000194435 GCGGATGCATATGAGAAGTGT pLKO.1 930 5UTR 100% 0.000 0.000 N Fam204a n/a
3 TRCN0000174893 GAAATCAAACTAGAGAACCCA pLKO.1 801 5UTR 100% 0.750 0.600 N Fam204a n/a
4 TRCN0000215365 CAGAGTTCTTCAAGACATTTA pLKO.1 1366 3UTR 100% 13.200 9.240 N Fam204a n/a
5 TRCN0000175689 GCTGCTCGAAAGAAGAAGAAA pLKO.1 1277 CDS 100% 5.625 3.938 N Fam204a n/a
6 TRCN0000193377 CCATATCTCAACCATGTCATT pLKO.1 2005 3UTR 100% 4.950 3.465 N Fam204a n/a
7 TRCN0000216560 GACTAAATGAAAGTGATGTTG pLKO.1 763 5UTR 100% 4.950 3.465 N Fam204a n/a
8 TRCN0000193326 CATAATTTACAGGAAGATGGA pLKO.1 834 5UTR 100% 2.640 1.848 N Fam204a n/a
9 TRCN0000129004 GAAGCAAAGAAGAGATGGGAA pLKO.1 1313 CDS 100% 2.640 1.584 N FAM204A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03904 pDONR223 100% 49.2% 48.9% None (many diffs) n/a
2 ccsbBroad304_03904 pLX_304 0% 49.2% 48.9% V5 (many diffs) n/a
3 TRCN0000470413 TTTTACGGCTAGGGGCCCAAACTT pLX_317 42.8% 49.2% 48.9% V5 (many diffs) n/a
Download CSV