Construct: ORF TRCN0000470461
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016856.1_s317c1
- Derived from:
- ccsbBroadEn_00197
- DNA Barcode:
- TTTGCGGTTGTTCACACACGGAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPPED1 (758)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470461
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 758 | MPPED1 | metallophosphoesterase doma... | NM_001044370.2 | 100% | 100% | |
2 | human | 758 | MPPED1 | metallophosphoesterase doma... | NM_001362786.1 | 100% | 100% | |
3 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | NM_172610.3 | 89.9% | 98.1% | (many diffs) |
4 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_006520817.3 | 89.9% | 98.1% | (many diffs) |
5 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_006520818.3 | 89.9% | 98.1% | (many diffs) |
6 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_006520819.2 | 89.9% | 98.1% | (many diffs) |
7 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_006520820.3 | 89.9% | 98.1% | (many diffs) |
8 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_017316573.1 | 89.9% | 98.1% | (many diffs) |
9 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XM_017316572.1 | 74% | 80.8% | (many diffs) |
10 | mouse | 223726 | Mpped1 | metallophosphoesterase doma... | XR_384004.2 | 13% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gcgctctagg tgggatgcca gcgtcctgaa ggcggaggcc ctggccctcc 121 tcccctgcgg cctgggcatg gcattctccc agtcccacgt gatggccgct cggcggcacc 181 agcacagccg gctcatcatc gaggtggacg agtacagctc caaccccacc caggccttca 241 ccttctacaa catcaaccag ggccgcttcc agccaccgca tgtgcagatg gtggacccgg 301 tgcctcacga tgcccccaaa cctccaggct acacccgctt cgtctgcgtc tctgataccc 361 actcgaggac ggaccccatc cagatgccgt acggcgacgt gctgatccac gctggggact 421 tcactgagct ggggctcccg agcgaggtga agaagttcaa cgagtggctg ggcagcctgc 481 cctacgagta caagatcgtg atcgcaggca accacgagct gacctttgac caggagttca 541 tggccgacct catcaagcag gacttttact acttcccatc tgtgtcgaag ctgaagccgg 601 agaactatga gaatgtgcag tcgctgctga ccaactgcat ctaccttcag gactcggagg 661 tcaccgtgcg gggcttccgg atctatggct ccCCATGGCA GCCCTGGTTC TACGGCTGGG 721 GCTTCAACCT CCCGCGAGGC CAAGCCCTGC TGGAGAAATG GAACCTCATT CCCGAAGGCG 781 TAGACATCCT GATAACCCAT GGACCACCAC TGGGCTTCCT GGACTGGGTC CCCAAGAAGA 841 TGCAGCGGGT GGGCTGTGTG GAGCTGCTCA ACACGGTGCA GAGGCGCGTC CAGCCGCGGT 901 TACATGTCTT TGGCCACATC CACGAAGGGT ATGGTGTCAT GGCAGATGGG ACGACCACCT 961 ATGTGAATGC GTCCGTATGC ACTGTGAACT ACCAGCCCGT GAACCCGCCC ATAGTCATCG 1021 ACCTCCCCAC ACCCCGGAAC TCCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT TTGCGGTTGT 1201 TCACACACGG AAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att