Transcript: Human NM_001044370.2

Homo sapiens metallophosphoesterase domain containing 1 (MPPED1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MPPED1 (758)
Length:
3436
CDS:
224..1204

Additional Resources:

NCBI RefSeq record:
NM_001044370.2
NBCI Gene record:
MPPED1 (758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001044370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050538 CCTATGTGAATGCGTCCGTAT pLKO.1 1116 CDS 100% 4.050 5.670 N MPPED1 n/a
2 TRCN0000050540 CTACGAGTACAAGATCGTGAT pLKO.1 640 CDS 100% 4.050 3.240 N MPPED1 n/a
3 TRCN0000050542 CCAGGCCTTCACCTTCTACAA pLKO.1 388 CDS 100% 4.950 3.465 N MPPED1 n/a
4 TRCN0000050539 GAAGGCGTAGACATCCTGATA pLKO.1 932 CDS 100% 4.950 3.465 N MPPED1 n/a
5 TRCN0000050541 GACCTCATCAAGCAGGACTTT pLKO.1 704 CDS 100% 4.950 3.465 N MPPED1 n/a
6 TRCN0000182734 GACCTCATCAAGCAGGACTTT pLKO.1 704 CDS 100% 4.950 3.465 N Mpped1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00197 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00197 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470461 TTTGCGGTTGTTCACACACGGAAG pLX_317 36.2% 100% 100% V5 n/a
Download CSV