Transcript: Mouse XM_017316572.1

PREDICTED: Mus musculus metallophosphoesterase domain containing 1 (Mpped1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpped1 (223726)
Length:
3805
CDS:
494..1684

Additional Resources:

NCBI RefSeq record:
XM_017316572.1
NBCI Gene record:
Mpped1 (223726)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177683 CAAGGACAGATCCCATTCAAA pLKO.1 1002 CDS 100% 5.625 3.938 N Mpped1 n/a
2 TRCN0000198028 CGGATGGAATTTGGGAAGTTT pLKO.1 2041 3UTR 100% 5.625 3.938 N Mpped1 n/a
3 TRCN0000050541 GACCTCATCAAGCAGGACTTT pLKO.1 1184 CDS 100% 4.950 3.465 N MPPED1 n/a
4 TRCN0000182734 GACCTCATCAAGCAGGACTTT pLKO.1 1184 CDS 100% 4.950 3.465 N Mpped1 n/a
5 TRCN0000182381 GCTTGTCAGTACCACCAGTAA pLKO.1 2611 3UTR 100% 4.950 3.465 N Mpped1 n/a
6 TRCN0000182309 GTGGACGAATACAGCTCCAAT pLKO.1 842 CDS 100% 4.950 3.465 N Mpped1 n/a
7 TRCN0000177073 GAAGGAGTAGACATCCTTATA pLKO.1 1412 CDS 100% 1.320 0.924 N Mpped1 n/a
8 TRCN0000050542 CCAGGCCTTCACCTTCTACAA pLKO.1 868 CDS 100% 4.950 2.970 N MPPED1 n/a
9 TRCN0000215933 CTATGAGTACAAGATCGTGAT pLKO.1 1120 CDS 100% 4.050 2.430 N Mpped1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00197 pDONR223 100% 74% 80.8% None (many diffs) n/a
2 ccsbBroad304_00197 pLX_304 0% 74% 80.8% V5 (many diffs) n/a
3 TRCN0000470461 TTTGCGGTTGTTCACACACGGAAG pLX_317 36.2% 74% 80.8% V5 (many diffs) n/a
Download CSV