Construct: ORF TRCN0000470463
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006129.1_s317c1
- Derived from:
- ccsbBroadEn_04557
- DNA Barcode:
- CCTACATCGAAGCCCTCCCCTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACY3 (91703)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470463
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 91703 | ACY3 | aminoacylase 3 | NM_080658.2 | 100% | 100% | |
| 2 | human | 91703 | ACY3 | aminoacylase 3 | XM_017018549.1 | 97.8% | 97.5% | 237_257del |
| 3 | human | 91703 | ACY3 | aminoacylase 3 | XM_017018550.1 | 97.8% | 97.5% | 237_257del |
| 4 | human | 91703 | ACY3 | aminoacylase 3 | XM_017018551.1 | 90.4% | 90.1% | 0_1ins72;165_185del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1023
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg ctcactgcct gtgccccggg agcccctgcg tcgcgtggct gtgactgggg 121 gcacgcatgg caacgagatg tcgggcgtct acctggcccg gcactggctg catgcccccg 181 cagagctgca gagagccagc ttctccgctg tgcctgtgct ggccaacccg gcagccacat 241 ccggctgccg ccgctacgtg gaccatgacc tcaaccgcac cttcaccagc agcttcctca 301 attccaggcc caccccggac gacccatatg aggtgacaag agcccgagag ctgaaccagc 361 tgctggggcc caaggcctcg ggccaggcct ttgactttgt ccttgacctg cacaacacca 421 cggccaacat gggcacctgc ttaatcgcga agtcctccca cgaagtcttt gccatgcacc 481 tgtgccgcca tctgcagctg cagtaccccg agctgtcctg ccaggtcttc ctgtaccagc 541 ggtctgggga ggagagctac aacctggact ctgtggccaa aaatggactg ggtctggagc 601 tgggccccca gccacagggt gtgctgcggg ctgacatttt ctcaaggatg aggaccctgg 661 tggccacagt tctggacttc atcgaactct tcaaccaggG TACGGCCTTT CCTGCCTTTG 721 AGATGGAAGC CTATAGACCC GTGGGCGTCG TGGACTTCCC CCGCACCGAG GCCGGGCACC 781 TGGCAGGCAC TGTGCATCCT CAGCTGCAGG ACCGAGACTT CCAGCCACTG CAGCCTGGTG 841 CTCCCATCTT CCAGATGTTC AGTGGGGAGG ACCTGCTCTA TGAGGGAGAG TCCACGGTGT 901 ACCCCGTGTT CATTAACGAG GCTGCCTACT ATGAGAAGGG CGTTGCCTTT GTCCAGACTG 961 AGAAGTTCAC ATTCACCGTG CCTGCCATGC CCGCGCTGAC CCCTGCCCCG AGCCCAGCTT 1021 CCTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGACC TACATCGAAG CCCTCCCCTC CCACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt