Transcript: Human XM_017018551.1

PREDICTED: Homo sapiens aminoacylase 3 (ACY3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACY3 (91703)
Length:
1450
CDS:
369..1277

Additional Resources:

NCBI RefSeq record:
XM_017018551.1
NBCI Gene record:
ACY3 (91703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437010 GCTTCCTAACCCAAGACACAC pLKO_005 1269 CDS 100% 4.050 5.670 N ACY3 n/a
2 TRCN0000048771 CTTTGTCCTTGACCTGCACAA pLKO.1 647 CDS 100% 4.050 3.240 N ACY3 n/a
3 TRCN0000048768 CCAGACTGAGAAGTTCACATT pLKO.1 1205 CDS 100% 4.950 3.465 N ACY3 n/a
4 TRCN0000445642 AGCTACAACCTGGACTCTGTG pLKO_005 807 CDS 100% 4.050 2.835 N ACY3 n/a
5 TRCN0000048770 GCCTACTATGAGAAGGGCGTT pLKO.1 1176 CDS 100% 2.160 1.512 N ACY3 n/a
6 TRCN0000048772 CCATGACCTCAACCGCACCTT pLKO.1 494 CDS 100% 0.880 0.616 N ACY3 n/a
7 TRCN0000048769 GCCTTTGAGATGGAAGCCTAT pLKO.1 966 CDS 100% 4.050 2.430 N ACY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04557 pDONR223 100% 90.4% 90.1% None 0_1ins72;165_185del n/a
2 ccsbBroad304_04557 pLX_304 0% 90.4% 90.1% V5 0_1ins72;165_185del n/a
3 TRCN0000470463 CCTACATCGAAGCCCTCCCCTCCC pLX_317 34.1% 90.4% 90.1% V5 0_1ins72;165_185del n/a
Download CSV