Construct: ORF TRCN0000470477
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007669.1_s317c1
- Derived from:
- ccsbBroadEn_10226
- DNA Barcode:
- CCGGCGGCCGCAACAATTGCAAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MOCS1 (4337)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470477
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001358533.2 | 94.2% | 93.9% | 842_849delGCATGTTC;852_894del |
| 2 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001358534.1 | 94.2% | 93.9% | 842_849delGCATGTTC;852_894del |
| 3 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001075098.4 | 72.9% | 72.7% | 1_261del;1103_1110delGCATGTTC;1113_1155del |
| 4 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_005943.5 | 72.9% | 72.7% | 1_261del;1103_1110delGCATGTTC;1113_1155del |
| 5 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001358531.2 | 51.1% | 51% | 842_849delGCATGTTC;852_1647del |
| 6 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001358529.2 | 45.3% | 45.3% | 1_261del;1105_1860del |
| 7 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NM_001358530.2 | 44.1% | 44% | 1_261del;1103_1110delGCATGTTC;1113_1908del |
| 8 | human | 4337 | MOCS1 | molybdenum cofactor synthes... | NR_033233.2 | 21.2% | 1_179del;1023_3968del | |
| 9 | mouse | 56738 | Mocs1 | molybdenum cofactor synthes... | NM_028464.1 | 64.3% | 68% | (many diffs) |
| 10 | mouse | 56738 | Mocs1 | molybdenum cofactor synthes... | XM_006524680.2 | 45.1% | 47.7% | (many diffs) |
| 11 | mouse | 56738 | Mocs1 | molybdenum cofactor synthes... | NM_020042.2 | 38.9% | 41.1% | (many diffs) |
| 12 | mouse | 56738 | Mocs1 | molybdenum cofactor synthes... | XM_006524681.2 | 27.5% | 29.1% | (many diffs) |
| 13 | mouse | 56738 | Mocs1 | molybdenum cofactor synthes... | XM_006524682.3 | 17.7% | 18.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 909
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc cgaggagggg gtcccgctga cccccaaagc caacctgctg accacagagg 121 agatcctgac cctcgcccgg ctctttgtga aggaaggcat cgacaagatc cggctcacag 181 gtggagagcc gcttatccgg ccggacgtgg tggacattgt ggcccagctc cagcggctgg 241 aagggctgag aaccataggt gttaccacca atggcatcaa cctggcccgg ctactgcccc 301 agcttcagaa ggctggtctc agtgccatca acatcagcct ggacaccctg gtgcctgcca 361 agtttgagtt cattgtccgc aggaaaggct tccacaaggt catggagggc atccacaagg 421 ccatcgagct gggctacaac cctgtgaagg tgaactgtgt ggtgatgcga ggccttaacg 481 aggatgaact cctggacttt gcggccttga ctgagggCCT CCCCCTGGAT GTGCGCTTCA 541 TAGAGTATAT GCCCTTTGAT GGCAACAAGT GGAACTTCAA GAAGATGGTC AGCTATAAGG 601 AGATGCTAGA CACTGTCCGG CAGCAGTGGC CAGAGCTGGA GAAGGTGCCA GAGGAGGAAT 661 CCAGCACAGC CAAGGCCTTT AAAATCCCTG GCTTCCAAGG CCAGATCAGC TTCATCACAT 721 CCATGTCTGA GCATTTCTGT GGGACCTGCA ACCGCCTGCG AATCACAGCT GATGGGAACC 781 TCAAGGTCTG CCTCTTTGGA AACTCTGAGG TATCCCTGCG GGATCACCTG CGAGCTGGGG 841 CCTCTGAGCA GGAGCTGCTG AGAATCATTG GGGCTGCTGT GGGCAGGAAG AAGCGGCAGC 901 ATGCAGAGTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 961 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1021 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACCGGCG GCCGCAACAA TTGCAAAGAC 1081 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt