Transcript: Mouse NM_020042.2

Mus musculus molybdenum cofactor synthesis 1 (Mocs1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mocs1 (56738)
Length:
2640
CDS:
79..1989

Additional Resources:

NCBI RefSeq record:
NM_020042.2
NBCI Gene record:
Mocs1 (56738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076250 ACCTCAAATCAGCTAACTCAT pLKO.1 1510 CDS 100% 4.950 6.930 N Mocs1 n/a
2 TRCN0000076252 CCCTCCGTGTTCGGAATCCAA pLKO.1 1289 CDS 100% 1.000 1.400 N Mocs1 n/a
3 TRCN0000076248 TCCCTCTAAATCTAGTGATTA pLKO.1 2055 3UTR 100% 13.200 10.560 N Mocs1 n/a
4 TRCN0000076251 CAGAGGTGAAGCTCATTAGTA pLKO.1 1931 CDS 100% 5.625 3.938 N Mocs1 n/a
5 TRCN0000076249 CAGAGACACTACAGCTCCTAT pLKO.1 1414 CDS 100% 4.950 3.465 N Mocs1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2197 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10226 pDONR223 100% 38.9% 41.1% None (many diffs) n/a
2 ccsbBroad304_10226 pLX_304 0% 38.9% 41.1% V5 (many diffs) n/a
3 TRCN0000470477 CCGGCGGCCGCAACAATTGCAAAG pLX_317 46.5% 38.9% 41.1% V5 (many diffs) n/a
Download CSV