Construct: ORF TRCN0000470493
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005631.1_s317c1
- Derived from:
- ccsbBroadEn_00032
- DNA Barcode:
- GCACGTTTTCGAGCTATGTGGATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADSL (158)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470493
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 158 | ADSL | adenylosuccinate lyase | NM_000026.4 | 100% | 100% | |
2 | human | 158 | ADSL | adenylosuccinate lyase | NM_001363840.2 | 98.9% | 98.7% | 1433_1434insGAAAGCAGAA;1436_1438delCCTinsATG;1440_1441insTG |
3 | human | 158 | ADSL | adenylosuccinate lyase | XM_017028637.1 | 96.9% | 96.9% | 357_358ins45 |
4 | human | 158 | ADSL | adenylosuccinate lyase | XM_011529977.3 | 91.6% | 91% | (many diffs) |
5 | human | 158 | ADSL | adenylosuccinate lyase | XM_017028636.1 | 88.7% | 88.2% | (many diffs) |
6 | human | 158 | ADSL | adenylosuccinate lyase | NM_001123378.2 | 87.8% | 87.8% | 1188_1189ins177 |
7 | human | 158 | ADSL | adenylosuccinate lyase | NM_001317923.1 | 86.7% | 86.7% | 0_1ins192 |
8 | human | 158 | ADSL | adenylosuccinate lyase | XR_002958670.1 | 85.2% | (many diffs) | |
9 | human | 158 | ADSL | adenylosuccinate lyase | XM_024452166.1 | 84.7% | 84.7% | 357_358ins45;1143_1144ins177 |
10 | human | 158 | ADSL | adenylosuccinate lyase | NR_134256.1 | 81.2% | 1_59del;1070_1100del;1543_1788del | |
11 | human | 158 | ADSL | adenylosuccinate lyase | XM_011529980.3 | 80.4% | 79.8% | (many diffs) |
12 | human | 158 | ADSL | adenylosuccinate lyase | XR_001755176.2 | 79.7% | 1_57del;848_1032del;1695_1821del | |
13 | human | 158 | ADSL | adenylosuccinate lyase | XR_937825.3 | 76.5% | (many diffs) | |
14 | human | 158 | ADSL | adenylosuccinate lyase | XM_017028639.2 | 67.9% | 67.1% | 0_1ins340;17_18ins125 |
15 | human | 158 | ADSL | adenylosuccinate lyase | XR_002958671.1 | 63.5% | (many diffs) | |
16 | human | 158 | ADSL | adenylosuccinate lyase | XM_017028638.1 | 62.1% | 60.8% | (many diffs) |
17 | human | 158 | ADSL | adenylosuccinate lyase | XM_017028640.1 | 39% | 38.4% | (many diffs) |
18 | mouse | 11564 | Adsl | adenylosuccinate lyase | NM_009634.6 | 86.7% | 94% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1518
- ORF length:
- 1452
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggctggaggc gatcatggtt cgcccgacag ctaccgctca cctcttgcct 121 cccgctatgc cagcccggag atgtgcttcg tgtttagcga caggtataaa ttccggacat 181 ggcggcagct gtggctgtgg ctggcggagg ccgagcagac attgggtttg cctatcacag 241 atgaacaaat ccaggagatg aaatcaaacc tggagaacat cgacttcaag atggcagctg 301 aggaagagaa acgtttacga catgatgtga tggctcacgt gcacacattt ggccactgct 361 gtccaaaagc tgcaggcatt attcaccttg gtgctacttc ttgctatgtt ggagacaata 421 ctgacttgat tattcttaga aatgcacttg acctgctttt gccaaagctt gccagagtga 481 tctctcggct tgccgacttt gctaaggaac gagccagtct acccacatta ggtttcacac 541 atttccagcc tgcacagctg accacagttg ggaaacgttg ctgtctttgg attcaggatc 601 tttgcatgga tctccagaac ttgaagcgtg tccgagatga cctgcgcttc cggggagtaa 661 agggtaccac tggcactcag gccagtttcc tgcagctctt tgagggagat gaccataagg 721 tagagcagct tgacaagatg gtgacagaaa aggcaggatt taagagagct ttcatcatca 781 cagggcagac atatacacga aaagtggata ttgaagtact gtctgtgctg gctagcttgg 841 gggcatcagt gcacaagatt tgcaccgaca tacgcctcct ggcaaacctc aaggagatgg 901 aggaaccctt tgaaaaacag cagattggct caagtgcgat gccatataag cggaatccca 961 tgcgttcaga acgttgctgc agtcttgccc gccacctGAT GACCCTTGTC ATGGACCCGC 1021 TACAGACAGC ATCTGTCCAG TGGTTTGAAC GCACACTGGA TGATAGTGCC AACCGACGGA 1081 TCTGTTTGGC CGAGGCATTT CTTACCGCAG ATACTATATT GAATACGCTG CAGAACATTT 1141 CTGAAGGATT GGTCGTGTAC CCCAAAGTAA TTGAACGGCG CATTCGGCAA GAGCTGCCTT 1201 TCATGGCCAC AGAGAACATC ATCATGGCCA TGGTCAAAGC TGGAGGTAGC CGCCAGGATT 1261 GCCATGAGAA AATCAGAGTG CTTTCTCAGC AGGCAGCTTC TGTGGTTAAG CAGGAAGGGG 1321 GTGACAATGA CCTCATAGAG CGTATCCAGG TTGATGCCTA CTTCAGTCCC ATTCACTCCC 1381 AGTTGGATCA TTTACTGGAT CCTTCTTCTT TCACTGGTCG TGCCTCCCAG CAGGTGCAGA 1441 GATTCTTAGA AGAGGAGGTG TATCCCCTGT TAAAACCATA TGAAAGCGTG ATGAAGGTGA 1501 AAGCAGAATT ATGTCTGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1561 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1621 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGCACGTT TTCGAGCTAT 1681 GTGGATGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt