Transcript: Human NR_134256.1

Homo sapiens adenylosuccinate lyase (ADSL), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-03-12
Taxon:
Homo sapiens (human)
Gene:
ADSL (158)
Length:
1788
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134256.1
NBCI Gene record:
ADSL (158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429211 ACAAGATTTGCACCGACATAC pLKO_005 847 3UTR 100% 10.800 15.120 N ADSL n/a
2 TRCN0000078272 CCACATTAGGTTTCACACATT pLKO.1 517 3UTR 100% 4.950 6.930 N ADSL n/a
3 TRCN0000078270 GCGATGCCATATAAGCGGAAT pLKO.1 930 3UTR 100% 4.050 5.670 N ADSL n/a
4 TRCN0000222697 CCTCGAGAATTGTTACCTTAA pLKO.1 1623 3UTR 100% 0.000 0.000 N ADSL n/a
5 TRCN0000413491 GTGTTTAGCGACAGGTATAAA pLKO_005 144 3UTR 100% 15.000 10.500 N ADSL n/a
6 TRCN0000078269 CCGCAGATACTATATTGAATA pLKO.1 1130 3UTR 100% 13.200 9.240 N ADSL n/a
7 TRCN0000412424 GAAGGTGAAAGCAGAATTATG pLKO_005 1518 3UTR 100% 13.200 9.240 N ADSL n/a
8 TRCN0000412787 GAGACAATACTGACTTGATTA pLKO_005 406 3UTR 100% 13.200 9.240 N ADSL n/a
9 TRCN0000430860 TGAACGCACACTGGATGATAG pLKO_005 1040 3UTR 100% 10.800 7.560 N ADSL n/a
10 TRCN0000435418 TTTGAGGGAGATGACCATAAG pLKO_005 693 3UTR 100% 10.800 7.560 N ADSL n/a
11 TRCN0000078271 GCAGAACATTTCTGAAGGATT pLKO.1 1155 3UTR 100% 4.950 3.465 N ADSL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00032 pDONR223 100% 81.2% None 1_59del;1070_1100del;1543_1788del n/a
2 ccsbBroad304_00032 pLX_304 0% 81.2% V5 1_59del;1070_1100del;1543_1788del n/a
3 TRCN0000470493 GCACGTTTTCGAGCTATGTGGATG pLX_317 36% 81.2% V5 1_59del;1070_1100del;1543_1788del n/a
Download CSV