Transcript: Human NM_001363840.2

Homo sapiens adenylosuccinate lyase (ADSL), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ADSL (158)
Length:
1761
CDS:
60..1502

Additional Resources:

NCBI RefSeq record:
NM_001363840.2
NBCI Gene record:
ADSL (158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429211 ACAAGATTTGCACCGACATAC pLKO_005 847 CDS 100% 10.800 15.120 N ADSL n/a
2 TRCN0000078272 CCACATTAGGTTTCACACATT pLKO.1 517 CDS 100% 4.950 6.930 N ADSL n/a
3 TRCN0000078270 GCGATGCCATATAAGCGGAAT pLKO.1 930 CDS 100% 4.050 5.670 N ADSL n/a
4 TRCN0000336313 CTCACTGCCACAGAGTATAAT pLKO_005 1515 3UTR 100% 15.000 10.500 N Scmh1 n/a
5 TRCN0000413491 GTGTTTAGCGACAGGTATAAA pLKO_005 144 CDS 100% 15.000 10.500 N ADSL n/a
6 TRCN0000078269 CCGCAGATACTATATTGAATA pLKO.1 1099 CDS 100% 13.200 9.240 N ADSL n/a
7 TRCN0000412787 GAGACAATACTGACTTGATTA pLKO_005 406 CDS 100% 13.200 9.240 N ADSL n/a
8 TRCN0000430860 TGAACGCACACTGGATGATAG pLKO_005 1040 CDS 100% 10.800 7.560 N ADSL n/a
9 TRCN0000435418 TTTGAGGGAGATGACCATAAG pLKO_005 693 CDS 100% 10.800 7.560 N ADSL n/a
10 TRCN0000078271 GCAGAACATTTCTGAAGGATT pLKO.1 1124 CDS 100% 4.950 3.465 N ADSL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00032 pDONR223 100% 98.9% 98.7% None 1433_1434insGAAAGCAGAA;1436_1438delCCTinsATG;1440_1441insTG n/a
2 ccsbBroad304_00032 pLX_304 0% 98.9% 98.7% V5 1433_1434insGAAAGCAGAA;1436_1438delCCTinsATG;1440_1441insTG n/a
3 TRCN0000470493 GCACGTTTTCGAGCTATGTGGATG pLX_317 36% 98.9% 98.7% V5 1433_1434insGAAAGCAGAA;1436_1438delCCTinsATG;1440_1441insTG n/a
Download CSV