Construct: ORF TRCN0000470495
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000248.1_s317c1
- Derived from:
- ccsbBroadEn_00898
- DNA Barcode:
- TCTTGCTACCGGTGACATTCTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNJ15 (3772)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470495
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_001276435.1 | 100% | 100% | |
2 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_001276436.1 | 100% | 100% | |
3 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_001276437.2 | 100% | 100% | |
4 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_001276438.2 | 100% | 100% | |
5 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_001276439.2 | 100% | 100% | |
6 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_002243.5 | 100% | 100% | |
7 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_170736.3 | 100% | 100% | |
8 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | NM_170737.2 | 100% | 100% | |
9 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_005260975.2 | 100% | 100% | |
10 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_006724002.2 | 100% | 100% | |
11 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_011529560.2 | 100% | 100% | |
12 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_011529561.2 | 100% | 100% | |
13 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_017028343.1 | 100% | 100% | |
14 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_017028344.1 | 100% | 100% | |
15 | human | 3772 | KCNJ15 | potassium inwardly rectifyi... | XM_017028345.1 | 100% | 100% | |
16 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001039056.2 | 85.7% | 96.2% | (many diffs) |
17 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271689.1 | 85.7% | 96.2% | (many diffs) |
18 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271691.1 | 85.7% | 96.2% | (many diffs) |
19 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271693.1 | 85.7% | 96.2% | (many diffs) |
20 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271695.1 | 85.7% | 96.2% | (many diffs) |
21 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_019664.5 | 85.7% | 96.2% | (many diffs) |
22 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522951.3 | 85.7% | 96.2% | (many diffs) |
23 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522952.3 | 85.7% | 96.2% | (many diffs) |
24 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_017316885.1 | 85.7% | 96.2% | (many diffs) |
25 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522950.3 | 82.2% | 92.3% | (many diffs) |
26 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001039057.2 | 80% | 89.8% | (many diffs) |
27 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271687.1 | 80% | 89.8% | (many diffs) |
28 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271690.1 | 80% | 89.8% | (many diffs) |
29 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271692.1 | 80% | 89.8% | (many diffs) |
30 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NM_001271694.1 | 80% | 89.8% | (many diffs) |
31 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522942.3 | 80% | 89.8% | (many diffs) |
32 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522944.3 | 80% | 89.8% | (many diffs) |
33 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522945.3 | 80% | 89.8% | (many diffs) |
34 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522946.3 | 80% | 89.8% | (many diffs) |
35 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_006522947.3 | 80% | 89.8% | (many diffs) |
36 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_017316883.1 | 80% | 89.8% | (many diffs) |
37 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | XM_017316884.1 | 80% | 89.8% | (many diffs) |
38 | mouse | 16516 | Kcnj15 | potassium inwardly-rectifyi... | NR_073406.1 | 17.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1191
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tgccattcac atcggcatgt ccagcacccc cctggtgaag cacactgctg 121 gggctgggct caaggccaac agaccccgcg tcatgtccaa gagtgggcac agcaacgtga 181 gaattgacaa agtggatggc atatacctac tctacctgca agacctgtgg accacagtta 241 tcgacatgaa gtggagatac aaactcaccc tgttcgctgc cacttttgtg atgacctggt 301 tcctttttgg agtcatctac tatgccatcg cgtttattca tggggactta gaacccggtg 361 agcccatttc aaatcatacc ccctgcatca tgaaagtgga ctctctcact ggggcgtttc 421 tcttttccct ggaatcccag acaaccattg gctatggagt ccgttccatc acagaggaat 481 gtcctcatgc catcttcctg ttggttgctc agttggtcat cacgaccttg attgagatct 541 tcatcaccgg aaccttcctg gccaaaatcg ccagacccaa aaagcgggct gagaccatca 601 agttcagcca ctgtgcagtc atcaccaagc agaatgggaa gctgtgcttg gtgattcagg 661 tagccaatat gaggaagagc ctcttgattc agtgccagct ctctggcaag ctcctgcaga 721 cccacgtcac caaggagggg gagcggattc tcctcaacca agccactgtc aaattccacg 781 tggactccTC CTCTGAGAGC CCCTTCCTCA TTCTGCCCAT GACATTCTAC CATGTGCTGG 841 ATGAGACGAG CCCCCTGAGA GACCTCACAC CCCAAAACCT AAAGGAGAAG GAGTTTGAGC 901 TTGTGGTCCT CCTCAATGCC ACTGTGGAAT CCACCAGCGC TGTCTGCCAG AGCCGAACAT 961 CTTATATCCC AGAGGAAATC TACTGGGGTT TTGAGTTTGT GCCTGTGGTA TCTCTCTCCA 1021 AAAATGGAAA ATATGTGGCT GATTTCAGTC AGTTTGAACA GATTCGGAAA AGCCCAGATT 1081 GCACATTTTA CTGTGCAGAT TCTGAGAAAC AGCAACTCGA GGAGAAGTAC AGGCAGGAGG 1141 ATCAGAGGGA AAGAGAACTG AGGACACTTT TATTACAACA GAGCAATGTC TGCCCAACTT 1201 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1261 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1321 CTTGTGGAAA GGACGATCTT GCTACCGGTG ACATTCTCCG ACGCGTTAAG TCgacaatca 1381 acctctggat tacaaaattt gtgaaagatt