Transcript: Human XM_017028345.1

PREDICTED: Homo sapiens potassium inwardly rectifying channel subfamily J member 15 (KCNJ15), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNJ15 (3772)
Length:
4006
CDS:
142..1269

Additional Resources:

NCBI RefSeq record:
XM_017028345.1
NBCI Gene record:
KCNJ15 (3772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424034 TACTATGCCATCGCGTTTATT pLKO_005 394 CDS 100% 15.000 21.000 N KCNJ15 n/a
2 TRCN0000424121 GAATAATGTCCTGTTAGATAA pLKO_005 1545 3UTR 100% 13.200 18.480 N KCNJ15 n/a
3 TRCN0000044608 CGACATGAAGTGGAGATACAA pLKO.1 318 CDS 100% 5.625 4.500 N KCNJ15 n/a
4 TRCN0000044612 CCAGAGCCGAACATCTTATAT pLKO.1 1023 CDS 100% 15.000 10.500 N KCNJ15 n/a
5 TRCN0000423494 GACAAAGTGGATGGCATATAC pLKO_005 262 CDS 100% 13.200 9.240 N KCNJ15 n/a
6 TRCN0000430377 AGAGCTTGGTGTAGGGCAATT pLKO_005 1523 3UTR 100% 10.800 7.560 N KCNJ15 n/a
7 TRCN0000044610 GCAGTCATCACCAAGCAGAAT pLKO.1 691 CDS 100% 4.950 3.465 N KCNJ15 n/a
8 TRCN0000044609 CCTGTGGTATCTCTCTCCAAA pLKO.1 1078 CDS 100% 4.950 2.970 N KCNJ15 n/a
9 TRCN0000044611 GCAGATTCTGAGAAACAGCAA pLKO.1 1171 CDS 100% 2.640 1.584 N KCNJ15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00898 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00898 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470495 TCTTGCTACCGGTGACATTCTCCG pLX_317 36% 100% 100% V5 n/a
Download CSV