Transcript: Mouse XM_006522951.3

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 15 (Kcnj15), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnj15 (16516)
Length:
2294
CDS:
485..1612

Additional Resources:

NCBI RefSeq record:
XM_006522951.3
NBCI Gene record:
Kcnj15 (16516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069661 CGATACAAGCTCACCCTATTT pLKO.1 674 CDS 100% 13.200 18.480 N Kcnj15 n/a
2 TRCN0000069658 CGACATGAAGTGGCGATACAA pLKO.1 661 CDS 100% 5.625 4.500 N Kcnj15 n/a
3 TRCN0000069660 GTGGCTGATTTCAGTCAATTT pLKO.1 1454 CDS 100% 13.200 9.240 N Kcnj15 n/a
4 TRCN0000069662 CCTGTGGTTTCTCTCTCCAAA pLKO.1 1421 CDS 100% 4.950 3.465 N Kcnj15 n/a
5 TRCN0000069659 GCCTTTATTCATGGTGACTTA pLKO.1 749 CDS 100% 4.950 3.465 N Kcnj15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00898 pDONR223 100% 85.7% 96.2% None (many diffs) n/a
2 ccsbBroad304_00898 pLX_304 0% 85.7% 96.2% V5 (many diffs) n/a
3 TRCN0000470495 TCTTGCTACCGGTGACATTCTCCG pLX_317 36% 85.7% 96.2% V5 (many diffs) n/a
Download CSV