Construct: ORF TRCN0000470559
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001331.1_s317c1
- Derived from:
- ccsbBroadEn_10852
- DNA Barcode:
- CGCAGTCCCGCCTCCTCAACACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GNAO1 (2775)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470559
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2775 | GNAO1 | G protein subunit alpha o1 | XM_011523003.3 | 96.5% | 96.1% | 1_30del;32G>T;35G>A |
2 | human | 2775 | GNAO1 | G protein subunit alpha o1 | NM_020988.3 | 85.3% | 85.3% | 1_156del |
3 | human | 2775 | GNAO1 | G protein subunit alpha o1 | NM_138736.3 | 77.5% | 79.6% | (many diffs) |
4 | mouse | 14681 | Gnao1 | guanine nucleotide binding ... | NM_010308.3 | 79.3% | 83.3% | (many diffs) |
5 | mouse | 14681 | Gnao1 | guanine nucleotide binding ... | NM_001113384.1 | 73% | 77.6% | (many diffs) |
6 | mouse | 14681 | Gnao1 | guanine nucleotide binding ... | XM_011248311.2 | 61.3% | 65.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 972
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gatcatccat gaagatggct tctccggaga agacgtgaaa cagtacaagc 121 ctgttgtcta cagcaacact atccagtccc tggcagccat cgtccgggcc atggacactt 181 tgggcatcga atatggtgat aaggagagaa aggctgacgc caagatggtg tgtgatgtgg 241 tgagtcggat ggaagacacc gagcccttct ctgcagagct gctttctgcc atgatgcggc 301 tctggggcga ctcaggaatc caagagtgct tcaaccggtc ccgggagtat cagctcaacg 361 actctgccaa atactacctg gacagcctgg atcggattgg ggccgccgac taccagccca 421 ccgagcagga catcctccga accagggtca aaaccactgg catcgtagaa acccacttca 481 cattcaagaa cctccacttc aggctgtttg acgtcggagg ccagcgatct gaacgcaaga 541 agtggatcca ttgcttcgag gacgtcacgg ccatcatttt ctgtgtcgcg ctcagcggct 601 atgaccaggt gcTCCACGAA GACGAAACCA CGAACCGCAT GCACGAGTCT CTCATGCTCT 661 TCGACTCCAT CTGTAACAAC AAGTTCTTCA TCGATACCTC CATCATTCTC TTCCTCAACA 721 AGAAAGATCT CTTTGGCGAG AAGATCAAGA AGTCACCTTT GACCATCTGC TTTCCTGAAT 781 ACACAGGCCC CAATACCTAT GAAGACGCAG CCGCCTACAT CCAAGCACAA TTTGAAAGCA 841 AAAACCGCTC ACCCAACAAA GAAATATATT GTCACATGAC TTGTGCCACA GACACGAATA 901 ACATCCAGGT GGTGTTCGAC GCCGTCACCG ACATCATCAT TGCCAACAAC CTCCGGGGCT 961 GCGGCTTGTA CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGC AGTCCCGCCT CCTCAACACC 1141 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t