Transcript: Mouse NM_010308.3

Mus musculus guanine nucleotide binding protein, alpha O (Gnao1), transcript variant A, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Gnao1 (14681)
Length:
2968
CDS:
499..1563

Additional Resources:

NCBI RefSeq record:
NM_010308.3
NBCI Gene record:
Gnao1 (14681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097756 CGAATAATATCCAGGTGGTAT pLKO.1 1484 CDS 100% 4.950 6.930 N Gnao1 n/a
2 TRCN0000097755 CGGCTGTGTATTTCTGTAGAA pLKO.1 1714 3UTR 100% 4.950 6.930 N Gnao1 n/a
3 TRCN0000097759 TCTCGGGAGTATCAGCTCAAT pLKO.1 928 CDS 100% 4.950 6.930 N Gnao1 n/a
4 TRCN0000327964 CTCACCATTTAATCCATATTT pLKO_005 1850 3UTR 100% 15.000 10.500 N Gnao1 n/a
5 TRCN0000036484 GCCGCCAAAGACGTGAAATTA pLKO.1 586 CDS 100% 15.000 10.500 N GNAO1 n/a
6 TRCN0000328024 GCCGCCAAAGACGTGAAATTA pLKO_005 586 CDS 100% 15.000 10.500 N Gnao1 n/a
7 TRCN0000097757 CGCTCACCCAACAAAGAAATT pLKO.1 1435 CDS 100% 13.200 9.240 N Gnao1 n/a
8 TRCN0000327952 TTGTGCCACAGACACGAATAA pLKO_005 1470 CDS 100% 13.200 9.240 N Gnao1 n/a
9 TRCN0000328027 GACCATCTGCTTTCCCGAATA pLKO_005 1350 CDS 100% 10.800 7.560 N Gnao1 n/a
10 TRCN0000328026 TCAACCGATCTCGGGAGTATC pLKO_005 920 CDS 100% 10.800 7.560 N Gnao1 n/a
11 TRCN0000036486 GCTCTTCGACTCCATCTGTAA pLKO.1 1245 CDS 100% 4.950 3.465 N GNAO1 n/a
12 TRCN0000097758 TCACCCTTGACCATCTGCTTT pLKO.1 1342 CDS 100% 4.950 3.465 N Gnao1 n/a
13 TRCN0000036487 CGCTCACCCAACAAAGAAATA pLKO.1 1435 CDS 100% 13.200 9.240 N GNAO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10852 pDONR223 100% 79.3% 83.3% None (many diffs) n/a
2 ccsbBroad304_10852 pLX_304 0% 79.3% 83.3% V5 (many diffs) n/a
3 TRCN0000470559 CGCAGTCCCGCCTCCTCAACACCG pLX_317 39.9% 79.3% 83.3% V5 (many diffs) n/a
Download CSV