Transcript: Human NM_020988.3

Homo sapiens G protein subunit alpha o1 (GNAO1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GNAO1 (2775)
Length:
3182
CDS:
748..1812

Additional Resources:

NCBI RefSeq record:
NM_020988.3
NBCI Gene record:
GNAO1 (2775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020988.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036484 GCCGCCAAAGACGTGAAATTA pLKO.1 835 CDS 100% 15.000 21.000 N GNAO1 n/a
2 TRCN0000328024 GCCGCCAAAGACGTGAAATTA pLKO_005 835 CDS 100% 15.000 21.000 N Gnao1 n/a
3 TRCN0000445022 AGGACGTCACGGCCATCATTT pLKO_005 1397 CDS 100% 13.200 9.240 N GNAO1 n/a
4 TRCN0000036487 CGCTCACCCAACAAAGAAATA pLKO.1 1684 CDS 100% 13.200 9.240 N GNAO1 n/a
5 TRCN0000036485 GCCTACATCCAAGCACAATTT pLKO.1 1651 CDS 100% 13.200 9.240 N GNAO1 n/a
6 TRCN0000435676 TTAGTTGAGTCTTCACATTTA pLKO_005 2002 3UTR 100% 13.200 9.240 N GNAO1 n/a
7 TRCN0000327952 TTGTGCCACAGACACGAATAA pLKO_005 1719 CDS 100% 13.200 9.240 N Gnao1 n/a
8 TRCN0000097755 CGGCTGTGTATTTCTGTAGAA pLKO.1 1964 3UTR 100% 4.950 3.465 N Gnao1 n/a
9 TRCN0000036486 GCTCTTCGACTCCATCTGTAA pLKO.1 1494 CDS 100% 4.950 3.465 N GNAO1 n/a
10 TRCN0000036488 TGGGCATCGAATATGGTGATA pLKO.1 1019 CDS 100% 4.950 3.465 N GNAO1 n/a
11 TRCN0000097757 CGCTCACCCAACAAAGAAATT pLKO.1 1684 CDS 100% 13.200 9.240 N Gnao1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020988.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10852 pDONR223 100% 85.3% 85.3% None 1_156del n/a
2 ccsbBroad304_10852 pLX_304 0% 85.3% 85.3% V5 1_156del n/a
3 TRCN0000470559 CGCAGTCCCGCCTCCTCAACACCG pLX_317 39.9% 85.3% 85.3% V5 1_156del n/a
Download CSV