Construct: ORF TRCN0000470604
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008097.1_s317c1
- Derived from:
- ccsbBroadEn_09271
- DNA Barcode:
- GTCCCGTGCCATTATCAATGTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RSPH1 (89765)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470604
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 89765 | RSPH1 | radial spoke head component 1 | NM_080860.4 | 99.8% | 100% | 393G>A |
| 2 | human | 89765 | RSPH1 | radial spoke head component 1 | XM_011529786.1 | 92.1% | 92.2% | 393G>A;501_502ins72 |
| 3 | human | 89765 | RSPH1 | radial spoke head component 1 | NM_001286506.2 | 87.5% | 87.7% | 53_54ins114;279G>A |
| 4 | human | 89765 | RSPH1 | radial spoke head component 1 | XM_005261208.2 | 77.3% | 77% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 996
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcggacctg ggctcggagg agttggagga ggagggagag aatgatattg 121 gggaatatga ggggggtcgg aatgaggcag gcgaaaggca cggacgtggg agggcacggc 181 tacccaacgg ggacacctac gaagggagct acgaattcgg taaaagacat ggccagggga 241 tctacaaatt taaaaatggt gctcgatata tcggagaata tgttagaaat aaaaagcacg 301 gtcaaggcac ttttatatat ccagatggat ccagatatga aggagagtgg gcaaatgacc 361 tgcggcacgg ccatggcgta tactactaca tcaataatga cacctacact ggagagtggt 421 ttgctcatca aaggcatggg caaggcacct atttatacgc agagacgggc agtaagtatg 481 ttggcacctg ggtgaacgga cagcaggagg gcacggccga gctcattcac ctgaaccaca 541 ggtaccaggg caagttcttg aacaaaaatc ctgttggccc tggaaagtat gtatttgatg 601 ttgggtgtga acaacatggt gaatatcGTT TAACAGATAT GGAAAGAGGA GAAGAGGAAG 661 AGGAGGAAGA ATTAGTAACT GTTGTTCCAA AATGGAAAGC TACCCAAATC ACTGAATTGG 721 CCCTGTGGAC ACCAACTCTC CCCAAAAAGC CGACCTCTAC GGATGGACCT GGCCAAGACG 781 CTCCAGGAGC TGAGAGTGCA GGAGAACCCG GGGAGGAGGC CCAGGCTCTG CTGGAGGGCT 841 TCGAGGGTGA GATGGACATG AGGCCTGGAG ATGAAGATGC AGACGTCCTC CGGGAAGAGA 901 GCCGGGAGTA TGACCAGGAG GAGTTCCGCT ATGACATGGA TGAGGGAAAC ATTAATTCTG 961 AAGAAGAAGA AACTAGACAG TCAGACCTCC AGGACTTGCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 AGTCCCGTGC CATTATCAAT GTGCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt