Transcript: Human NM_001286506.2

Homo sapiens radial spoke head component 1 (RSPH1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RSPH1 (89765)
Length:
1186
CDS:
39..854

Additional Resources:

NCBI RefSeq record:
NM_001286506.2
NBCI Gene record:
RSPH1 (89765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078718 CGAGAGGAGATCGTATCATAA pLKO.1 867 3UTR 100% 13.200 18.480 N RSPH1 n/a
2 TRCN0000078719 GCTCGATATATCGGAGAATAT pLKO.1 117 CDS 100% 13.200 18.480 N RSPH1 n/a
3 TRCN0000078722 GCACCTATTTATACGCGGAGA pLKO.1 301 CDS 100% 2.160 3.024 N RSPH1 n/a
4 TRCN0000078721 GCGTATACTACTACATCAATA pLKO.1 232 CDS 100% 13.200 9.240 N RSPH1 n/a
5 TRCN0000419549 AGAGTGGTTTGCTCATCAAAG pLKO_005 269 CDS 100% 10.800 7.560 N RSPH1 n/a
6 TRCN0000415889 CAACATGGTGAATATCGTTTA pLKO_005 468 CDS 100% 10.800 7.560 N RSPH1 n/a
7 TRCN0000078720 CCTGGAAAGTATGTATTTGAT pLKO.1 435 CDS 100% 5.625 3.938 N RSPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286506.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04490 pDONR223 100% 87.7% 87.7% None 53_54ins114 n/a
2 ccsbBroad304_04490 pLX_304 0% 87.7% 87.7% V5 53_54ins114 n/a
3 TRCN0000478133 ATTTGCTCCAATCACCCGAGGAGT pLX_317 44.9% 87.6% 56.3% V5 (not translated due to prior stop codon) 53_54ins114;520_521insC n/a
4 ccsbBroadEn_09271 pDONR223 100% 87.5% 87.7% None 53_54ins114;279G>A n/a
5 TRCN0000470604 GTCCCGTGCCATTATCAATGTGCA pLX_317 39.8% 87.5% 87.7% V5 53_54ins114;279G>A n/a
Download CSV