Construct: ORF TRCN0000470704
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003707.1_s317c1
- Derived from:
- ccsbBroadEn_06436
- DNA Barcode:
- AGTAAGATCGCACATCGACCCTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGLL1 (3543)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470704
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3543 | IGLL1 | immunoglobulin lambda like ... | NM_020070.4 | 99.8% | 99.5% | 625C>A |
| 2 | human | 3543 | IGLL1 | immunoglobulin lambda like ... | NM_001369906.1 | 99.3% | 99% | 203_205delGCA;628C>A |
| 3 | human | 100423062 | IGLL5 | immunoglobulin lambda like ... | NM_001256296.2 | 57.1% | 40.8% | (many diffs) |
| 4 | human | 91353 | IGLL3P | immunoglobulin lambda like ... | NR_029395.1 | 47.7% | (many diffs) | |
| 5 | human | 3543 | IGLL1 | immunoglobulin lambda like ... | NM_152855.3 | 39.4% | 34.7% | 206_207ins116;252_253ins271 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 705
- ORF length:
- 639
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gccagggaca ggccaggggg gccttgaggc ccctggtgag ccaggcccca 121 acctcaggca gcgctggccc ctgctgctgc tgggtctggc cgtggtaacc catggcctgc 181 tgcgcccaac agctgcatcg cagagcaggg ccctgggccc tggagcccct ggaggaagca 241 gccggtccag cctgaggagc cggtggggca ggttcctgct ccagcgcggc tcctggactg 301 gccccaggtg ctggccccgg gggtttcaat ccaagcataa ctcagtgacg catgtgtttg 361 gcagcgggac ccagctcacc gttttaagtc agcccaaggc caccccctcg gtcactctgt 421 tcccgccgtc ctctgaggag ctccaagcca acaaggctac actggtgtgt ctcatgaatg 481 acttttatcc gggaatcttG ACGGTGACCT GGAAGGCAGA TGGTACCCCC ATCACCCAGG 541 GCGTGGAGAT GACCACGCCC TCCAAACAGA GCAACAACAA GTACGCGGCC AGCAGCTACC 601 TGAGCCTGAC GCCCGAGCAG TGGAGGTCCC GCAGAAGCTA CAGCTGCCAG GTCATGCACG 661 AAGGGAGCAC CGTGGAGAAG ACGGTGGCCA CTGCAGAATG TTCATACCCA ACTTTCTTGT 721 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 781 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 841 GAAAGGACGA AGTAAGATCG CACATCGACC CTGTACGCGT TAAGTCgaca atcaacctct 901 ggattacaaa atttgtgaaa gatt