Transcript: Human NM_020070.4

Homo sapiens immunoglobulin lambda like polypeptide 1 (IGLL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGLL1 (3543)
Length:
883
CDS:
101..742

Additional Resources:

NCBI RefSeq record:
NM_020070.4
NBCI Gene record:
IGLL1 (3543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020070.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057083 CAAGCATAACTCAGTGACGCA pLKO.1 367 CDS 100% 0.660 0.462 N IGLL1 n/a
2 TRCN0000057087 GCCCAACAGCTGCATCGCAGA pLKO.1 219 CDS 100% 0.000 0.000 N IGLL1 n/a
3 TRCN0000372452 ATCCGGGAATCTTGACGGTGA pLKO_005 522 CDS 100% 2.160 1.296 N IGLL1 n/a
4 TRCN0000057084 CGAAGGGAGCACCGTGGAGAA pLKO.1 694 CDS 100% 0.000 0.000 N IGLL1 n/a
5 TRCN0000057085 CGCATGTGTTTGGCAGCGGGA pLKO.1 384 CDS 100% 0.000 0.000 N IGLL1 n/a
6 TRCN0000372515 CACTGGTGTGTCTCATGAATG pLKO_005 495 CDS 100% 10.800 5.400 Y IGLL1 n/a
7 TRCN0000372513 TGAGGAGCTCCAAGCCAACAA pLKO_005 469 CDS 100% 4.950 2.475 Y IGLL1 n/a
8 TRCN0000372516 ACAGAGCAACAACAAGTACGC pLKO_005 601 CDS 100% 2.160 1.080 Y IGLL1 n/a
9 TRCN0000057086 GCGTGGAGATGACCACGCCCT pLKO.1 576 CDS 100% 0.000 0.000 Y IGLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020070.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06436 pDONR223 100% 99.8% 99.5% None 625C>A n/a
2 ccsbBroad304_06436 pLX_304 0% 99.8% 99.5% V5 625C>A n/a
3 TRCN0000470704 AGTAAGATCGCACATCGACCCTGT pLX_317 32.7% 99.8% 99.5% V5 625C>A n/a
4 ccsbBroadEn_10913 pDONR223 99.3% 57.2% 41.7% None (many diffs) n/a
5 ccsbBroad304_10913 pLX_304 0% 57.2% 41.7% V5 (many diffs) n/a
Download CSV