Transcript: Human NM_152855.3

Homo sapiens immunoglobulin lambda like polypeptide 1 (IGLL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGLL1 (3543)
Length:
767
CDS:
101..355

Additional Resources:

NCBI RefSeq record:
NM_152855.3
NBCI Gene record:
IGLL1 (3543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057087 GCCCAACAGCTGCATCGCAGA pLKO.1 219 CDS 100% 0.000 0.000 N IGLL1 n/a
2 TRCN0000372452 ATCCGGGAATCTTGACGGTGA pLKO_005 406 3UTR 100% 2.160 1.296 N IGLL1 n/a
3 TRCN0000057084 CGAAGGGAGCACCGTGGAGAA pLKO.1 578 3UTR 100% 0.000 0.000 N IGLL1 n/a
4 TRCN0000372515 CACTGGTGTGTCTCATGAATG pLKO_005 379 3UTR 100% 10.800 5.400 Y IGLL1 n/a
5 TRCN0000372513 TGAGGAGCTCCAAGCCAACAA pLKO_005 353 CDS 100% 4.950 2.475 Y IGLL1 n/a
6 TRCN0000372516 ACAGAGCAACAACAAGTACGC pLKO_005 485 3UTR 100% 2.160 1.080 Y IGLL1 n/a
7 TRCN0000057086 GCGTGGAGATGACCACGCCCT pLKO.1 460 3UTR 100% 0.000 0.000 Y IGLL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06436 pDONR223 100% 39.4% 34.7% None 206_207ins116;252_253ins271 n/a
2 ccsbBroad304_06436 pLX_304 0% 39.4% 34.7% V5 206_207ins116;252_253ins271 n/a
3 TRCN0000470704 AGTAAGATCGCACATCGACCCTGT pLX_317 32.7% 39.4% 34.7% V5 206_207ins116;252_253ins271 n/a
4 ccsbBroadEn_10913 pDONR223 99.3% 24% 6.5% None (many diffs) n/a
5 ccsbBroad304_10913 pLX_304 0% 24% 6.5% V5 (many diffs) n/a
Download CSV