Construct: ORF TRCN0000470707
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005066.1_s317c1
- Derived from:
- ccsbBroadEn_12150
- DNA Barcode:
- ACTGTATACTAGCTCGATAGAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA6L (55064)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470707
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353486.2 | 99.7% | 99.4% | 512A>G;567A>G;727A>G |
| 2 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353484.2 | 96.3% | 95.8% | (many diffs) |
| 3 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353485.2 | 96.3% | 95.8% | (many diffs) |
| 4 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_006716795.2 | 96.3% | 95.8% | (many diffs) |
| 5 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_017014882.2 | 96.3% | 95.8% | (many diffs) |
| 6 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_017014883.2 | 96.3% | 95.8% | (many diffs) |
| 7 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_024447596.1 | 96.3% | 95.8% | (many diffs) |
| 8 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353487.1 | 91.3% | 91% | (many diffs) |
| 9 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_024447597.1 | 91.3% | 91% | (many diffs) |
| 10 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_006716800.3 | 88.1% | 87.6% | (many diffs) |
| 11 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_011517952.2 | 88.1% | 87.6% | (many diffs) |
| 12 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001039395.4 | 84.9% | 84.6% | (many diffs) |
| 13 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_017014885.1 | 76.7% | 76.3% | 227_268del;471_472ins240;529A>G |
| 14 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353488.1 | 76.5% | 76.2% | (many diffs) |
| 15 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353489.1 | 71.9% | 71.6% | (many diffs) |
| 16 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353490.1 | 71.9% | 71.6% | (many diffs) |
| 17 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_006716801.2 | 71.9% | 71.6% | (many diffs) |
| 18 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_011517954.1 | 71.9% | 71.6% | (many diffs) |
| 19 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_024447598.1 | 71% | 70.9% | 0_1ins99;330_331ins240;388A>G |
| 20 | human | 55064 | SPATA6L | spermatogenesis associated ... | NM_001353491.2 | 67.7% | 63.7% | (many diffs) |
| 21 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_011517957.1 | 67.7% | 63.7% | (many diffs) |
| 22 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_011517958.1 | 67.7% | 63.7% | (many diffs) |
| 23 | human | 55064 | SPATA6L | spermatogenesis associated ... | XM_024447599.1 | 67.7% | 63.7% | (many diffs) |
| 24 | human | 55064 | SPATA6L | spermatogenesis associated ... | NR_148445.2 | 65% | (many diffs) | |
| 25 | human | 55064 | SPATA6L | spermatogenesis associated ... | NR_148444.2 | 61.8% | (many diffs) | |
| 26 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746335.2 | 57.8% | (many diffs) | |
| 27 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746336.1 | 33.1% | (many diffs) | |
| 28 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746340.1 | 29.8% | (many diffs) | |
| 29 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746337.1 | 29.8% | (many diffs) | |
| 30 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746338.1 | 24.9% | (many diffs) | |
| 31 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746341.1 | 24.4% | (many diffs) | |
| 32 | human | 55064 | SPATA6L | spermatogenesis associated ... | NR_148447.1 | 23.7% | (many diffs) | |
| 33 | human | 55064 | SPATA6L | spermatogenesis associated ... | NR_148446.2 | 23% | (many diffs) | |
| 34 | human | 55064 | SPATA6L | spermatogenesis associated ... | NR_148443.2 | 19.8% | (many diffs) | |
| 35 | human | 55064 | SPATA6L | spermatogenesis associated ... | XR_001746339.1 | 16.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tctggaggtg gtggtggagc tgcagatccg ggcgatttct tgcccaggag 121 tgttcctgcc tggcaaacaa gatgtgtacc tcggggtcta cctcatgaat cagtacctgg 181 agaccaacag ctttccctct gcgttcccca ttatgattca ggagagcatg agatttgaaa 241 aggtatttga aagtgcagta gatcctggag ctgtagtaga ccttttggaa atgtgggatg 301 agttggccta ctacgaagaa aacacacgag attttctttt cccagagccc aagctgacac 361 cttcgcaccc taggaggtgt agggaggtgc tcatgaagac ggctctgggt tttccaggca 421 ttgctcccaa aatagagttt tctacaagga cagccatcag agaatgtgtg tttctgcata 481 gaaacagatt tcttgaagaa agacatgagt cacggaggcc tttatctaca tcacatgaac 541 caatatttcc cttaaatact ataaagatga aactaaggga gaataatctc aacagactgc 601 ccaaaggcat gcaagcccgg gcgccctctc agtattctac caggcatttc ttccaggacc 661 agccagctca gttgaacctt ggaaataatt tcaaaatctc tggaggaagc aagcctccat 721 ttgttgttag acacgtggac agtgcaaagc cctttGGTGA GAATATTTCA GAGCATCATT 781 TGAGGAGGTC TGGAAGAAAA TCTAAGTTTT CAGACTTTCC GTTTCCAACG AGAAGAGCTT 841 CTTCTCTTGA CAGCCTTGCA GCTAACGTAA AGGTTATCAA AGAGCCAGAT GAACGGATTG 901 TTTTAAGGAG TGACTCATCA TCATGTTTAG ATTCAAGTCA GTTTGGAAAG TCTTCATCCA 961 GTAAACAAGG GGATGCTGAT TTCCACGGGA AAGCTTCATT TGCCACCTAC CAGCATTCCA 1021 CCTCTCCTGG CCCCTTGGAT CAGCCCCTTC TCAGAGAAAG GTTCCATCCT GGTTCTCAGT 1081 CCACATGGAA GAATATCCAT GAGAGGGTAT GCAGTCTTCT GACATCCCAC AGAGCACAGC 1141 TGCACCAAAA CAAGGAAGAT TCTACCTCTG AAGTAAATTA TATCATTGAA AGACCAAGCT 1201 ACCCTCTGAA GAAATACTCA CTGCATGAAC AGAGATATTT TTACCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGAACT GTATACTAGC TCGATAGAAC TACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t