Transcript: Human XM_011517957.1

PREDICTED: Homo sapiens spermatogenesis associated 6 like (SPATA6L), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA6L (55064)
Length:
3941
CDS:
637..1446

Additional Resources:

NCBI RefSeq record:
XM_011517957.1
NBCI Gene record:
SPATA6L (55064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180347 GAGTTGGCCTACTACGAAGAA pLKO.1 372 5UTR 100% 4.950 6.930 N SPATA6L n/a
2 TRCN0000183747 CTACATCACATGAACCAATAT pLKO.1 728 CDS 100% 13.200 9.240 N SPATA6L n/a
3 TRCN0000180880 GCAAAGCCCTTTGGTGAGAAT pLKO.1 946 CDS 100% 4.950 3.465 N SPATA6L n/a
4 TRCN0000180951 GCCTGGCAAACAAGATGTGTA pLKO.1 249 5UTR 100% 4.950 3.465 N SPATA6L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12150 pDONR223 100% 67.7% 63.7% None (many diffs) n/a
2 ccsbBroad304_12150 pLX_304 0% 67.7% 63.7% V5 (many diffs) n/a
3 TRCN0000470707 ACTGTATACTAGCTCGATAGAACT pLX_317 41.5% 67.7% 63.7% V5 (many diffs) n/a
Download CSV