Transcript: Human XR_001746336.1

PREDICTED: Homo sapiens spermatogenesis associated 6 like (SPATA6L), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA6L (55064)
Length:
3535
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746336.1
NBCI Gene record:
SPATA6L (55064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180347 GAGTTGGCCTACTACGAAGAA pLKO.1 376 3UTR 100% 4.950 6.930 N SPATA6L n/a
2 TRCN0000183747 CTACATCACATGAACCAATAT pLKO.1 602 3UTR 100% 13.200 9.240 N SPATA6L n/a
3 TRCN0000180880 GCAAAGCCCTTTGGTGAGAAT pLKO.1 820 3UTR 100% 4.950 3.465 N SPATA6L n/a
4 TRCN0000180951 GCCTGGCAAACAAGATGTGTA pLKO.1 162 3UTR 100% 4.950 3.465 N SPATA6L n/a
5 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3515 3UTR 100% 4.950 2.475 Y ERN2 n/a
6 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3515 3UTR 100% 4.950 2.475 Y P3H4 n/a
7 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3515 3UTR 100% 4.950 2.475 Y P3H4 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3517 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3517 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12150 pDONR223 100% 33.1% None (many diffs) n/a
2 ccsbBroad304_12150 pLX_304 0% 33.1% V5 (many diffs) n/a
3 TRCN0000470707 ACTGTATACTAGCTCGATAGAACT pLX_317 41.5% 33.1% V5 (many diffs) n/a
4 ccsbBroadEn_12149 pDONR223 100% 13.7% None (many diffs) n/a
5 ccsbBroad304_12149 pLX_304 0% 13.7% V5 (many diffs) n/a
6 TRCN0000491755 CCTTTACTTAGGCAGGTTAATAGA pLX_317 76.5% 13.7% V5 (many diffs) n/a
Download CSV