Construct: ORF TRCN0000470741
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017349.1_s317c1
- Derived from:
- ccsbBroadEn_00240
- DNA Barcode:
- TAAGGGGGAGTCAGTTCCATCTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCNH (902)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470741
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 902 | CCNH | cyclin H | NM_001239.4 | 100% | 100% | |
| 2 | human | 902 | CCNH | cyclin H | NM_001364075.2 | 96.6% | 95.6% | (many diffs) |
| 3 | human | 902 | CCNH | cyclin H | XM_005248627.4 | 95.2% | 94.8% | (many diffs) |
| 4 | human | 902 | CCNH | cyclin H | NM_001363539.1 | 95.1% | 93.6% | (many diffs) |
| 5 | human | 902 | CCNH | cyclin H | NM_001199189.1 | 83.5% | 83.5% | 0_1ins159 |
| 6 | human | 902 | CCNH | cyclin H | XM_005248629.4 | 79.3% | 78.7% | (many diffs) |
| 7 | human | 902 | CCNH | cyclin H | NM_001364076.2 | 79.1% | 77.7% | (many diffs) |
| 8 | human | 902 | CCNH | cyclin H | NR_157070.2 | 37.6% | (many diffs) | |
| 9 | human | 902 | CCNH | cyclin H | NR_157068.2 | 34.3% | (many diffs) | |
| 10 | human | 902 | CCNH | cyclin H | NR_157069.2 | 31.1% | (many diffs) | |
| 11 | human | 902 | CCNH | cyclin H | XR_001742327.2 | 19.6% | 1_177del;698_699ins164;983_3938del | |
| 12 | human | 902 | CCNH | cyclin H | NR_157071.2 | 18% | (many diffs) | |
| 13 | mouse | 66671 | Ccnh | cyclin H | NM_023243.6 | 89.8% | 95% | (many diffs) |
| 14 | mouse | 66671 | Ccnh | cyclin H | NM_001347587.1 | 79.9% | 84.5% | (many diffs) |
| 15 | mouse | 66671 | Ccnh | cyclin H | NM_001347588.1 | 72.7% | 76.4% | (many diffs) |
| 16 | mouse | 66671 | Ccnh | cyclin H | XM_006517325.3 | 62.6% | 66.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta ccacaacagt agtcagaagc ggcactggac cttctccagc gaggagcagc 121 tggcaagact gcgggctgac gccaaccgca aattcagatg caaagccgtg gccaacggga 181 aggttcttcc gaatgatcca gtctttcttg agcctcatga agaaatgaca ctctgcaaat 241 actatgagaa aaggttattg gaattctgtt cggtgtttaa gccagcaatg ccaagatctg 301 ttgtgggtac ggcttgtatg tatttcaaac gtttttatct taataactca gtaatggaat 361 atcaccccag gataataatg ctcacttgtg catttttggc ctgcaaagta gatgaattca 421 atgtatctag tcctcagttt gttggaaacc tccgggagag tcctcttgga caggagaagg 481 cacttgaaca gatactggaa tatgaactac ttcttataca gcaacttaat ttccacctta 541 ttgtccacaa tccttacaga ccatttgagg gcttcctcat cgacttaaag acccgctatc 601 ccatattgga gaatccagag attttgagga aaacagctga tgactttctt aatagaattg 661 cattgacgga tgcttacctt ttatacacac cttcccaaat tgccctgact gccattttat 721 ctagtgcctc cagggctGGA ATTACTATGG AAAGTTATTT ATCAGAGAGT CTGATGCTGA 781 AAGAGAACAG AACTTGCCTG TCACAGTTAC TAGATATAAT GAAAAGCATG AGAAACTTAG 841 TAAAGAAGTA TGAACCACCC AGATCTGAAG AAGTTGCTGT TCTGAAACAG AAGTTGGAGC 901 GATGTCATTC TGCTGAGCTT GCACTTAACG TAATCACGAA GAAGAGGAAA GGCTATGAAG 961 ATGATGATTA CGTCTCAAAG AAATCCAAAC ATGAGGAGGA AGAATGGACT GATGACGACC 1021 TGGTAGAATC TCTCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAAGGGGGAG TCAGTTCCAT 1201 CTCAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt