Transcript: Human NM_001364076.2

Homo sapiens cyclin H (CCNH), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CCNH (902)
Length:
4621
CDS:
539..1357

Additional Resources:

NCBI RefSeq record:
NM_001364076.2
NBCI Gene record:
CCNH (902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001364076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020221 CGCTATCCCATATTGGAGAAT pLKO.1 908 CDS 100% 4.950 6.930 N CCNH n/a
2 TRCN0000020219 GCAACTTAATTTCCACCTTAT pLKO.1 835 CDS 100% 10.800 7.560 N CCNH n/a
3 TRCN0000343014 GCAACTTAATTTCCACCTTAT pLKO_005 835 CDS 100% 10.800 7.560 N CCNH n/a
4 TRCN0000020220 CCAGGATAATAATGCTCACTT pLKO.1 681 CDS 100% 4.950 3.465 N CCNH n/a
5 TRCN0000342951 CCAGGATAATAATGCTCACTT pLKO_005 681 CDS 100% 4.950 3.465 N CCNH n/a
6 TRCN0000020222 CTTCCGAATGATCCAGTCTTT pLKO.1 500 5UTR 100% 4.950 3.465 N CCNH n/a
7 TRCN0000343013 CTTCCGAATGATCCAGTCTTT pLKO_005 500 5UTR 100% 4.950 3.465 N CCNH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05950 pDONR223 100% 79.1% 77.7% None (many diffs) n/a
2 ccsbBroad304_05950 pLX_304 0% 79.1% 77.7% V5 (many diffs) n/a
3 TRCN0000468241 GGACTCTTCTTTCCTCCACTGTGA pLX_317 44.2% 79.1% 77.7% V5 (many diffs) n/a
4 ccsbBroadEn_00240 pDONR223 100% 79.1% 77.7% None (many diffs) n/a
5 ccsbBroad304_00240 pLX_304 0% 79.1% 77.7% V5 (many diffs) n/a
6 TRCN0000470741 TAAGGGGGAGTCAGTTCCATCTCA pLX_317 31.1% 79.1% 77.7% V5 (many diffs) n/a
7 ccsbBroadEn_05951 pDONR223 100% 79% 77.4% None (many diffs) n/a
8 ccsbBroad304_05951 pLX_304 0% 79% 77.4% V5 (many diffs) n/a
9 TRCN0000474982 TCTTAGTCCGCCAGCATACCGTAA pLX_317 42.4% 79% 77.4% V5 (many diffs) n/a
Download CSV