Construct: ORF TRCN0000470780
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017947.1_s317c1
- Derived from:
- ccsbBroadEn_05792
- DNA Barcode:
- GTCCGCACCATCAAATTTATTTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AGTR1 (185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470780
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_000685.4 | 99.7% | 99.4% | 573C>T;664C>G;1022C>A |
| 2 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_009585.3 | 99.7% | 99.4% | 573C>T;664C>G;1022C>A |
| 3 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_032049.3 | 92.2% | 92% | (many diffs) |
| 4 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_004835.4 | 90.8% | 90.6% | (many diffs) |
| 5 | human | 185 | AGTR1 | angiotensin II receptor type 1 | NM_031850.3 | 90.8% | 90.6% | (many diffs) |
| 6 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | NM_177322.3 | 86.7% | 93.8% | (many diffs) |
| 7 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_006516534.1 | 86.7% | 93.8% | (many diffs) |
| 8 | mouse | 11607 | Agtr1a | angiotensin II receptor, ty... | XM_011244264.2 | 86.7% | 93.8% | (many diffs) |
| 9 | mouse | 11608 | Agtr1b | angiotensin II receptor, ty... | NM_175086.3 | 85.4% | 92.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat tctcaactct tctactgaag atggtattaa aagaatccaa gatgattgtc 121 ccaaagctgg aaggcataat tacatatttg tcatgattcc tactttatac agtatcatct 181 ttgtggtggg aatatttgga aacagcttgg tggtgatagt catttacttt tatatgaagc 241 tgaagactgt ggccagtgtt tttcttttga atttagcact ggctgactta tgctttttac 301 tgactttgcc actatgggct gtctacacag ctatggaata ccgctggccc tttggcaatt 361 acctatgtaa gattgcttca gccagcgtca gtttcaacct gtacgctagt gtgtttctac 421 tcacgtgtct cagcattgat cgatacctgg ctattgttca cccaatgaag tcccgccttc 481 gacgcacaat gcttgtagcc aaagtcacct gcatcatcat ttggctgctg gcaggcttgg 541 ccagtttgcc agctataatc catcgaaatg tatttttcat tgagaacacc aatattacag 601 tttgtgcttt ccattatgag tcccaaaatt caacccttcc gatagggctg ggcctgacca 661 aaaatatact gggtttcctg tttccttttc tgatcattct tacaagttat actcttattt 721 ggaaggccgt aaagaaggct tatgaaattc agaagaacaa accaagaaat gatgatattt 781 ttaagataat tatggcaatt gtgcttttct ttttcttttc ctggattccc caccaaatat 841 tcacttttct ggatgtattg attcaactag gcatcatacg tgactgtaga attgcagata 901 ttgtggacac ggcCATGCCT ATCACCATTT GTATAGCTTA TTTTAACAAT TGCCTGAATC 961 CTCTTTTTTA TGGCTTTCTG GGGAAAAAAT TTAAAAGATA TTTTCTCCAG CTTCTAAAAT 1021 ATATTCCCCC AAAAGCCAAA TCCCACTCAA ACCTTTCAAC AAAAATGAGC ACGCTTTCCT 1081 ACCGCCACTC AGATAATGTA AGCTCATCCA CCAAGAAGCC TGCACCATGT TTTGAGGTTG 1141 AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGAGT CCGCACCATC AAATTTATTT TAACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt