Transcript: Human NM_000685.4

Homo sapiens angiotensin II receptor type 1 (AGTR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
AGTR1 (185)
Length:
2362
CDS:
389..1468

Additional Resources:

NCBI RefSeq record:
NM_000685.4
NBCI Gene record:
AGTR1 (185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008093 GCCAGCTATAATCCATCGAAA pLKO.1 871 CDS 100% 4.950 6.930 N AGTR1 n/a
2 TRCN0000378138 GGCCAGTTTGCCAGCTATAAT pLKO_005 862 CDS 100% 15.000 10.500 N AGTR1 n/a
3 TRCN0000356697 TCATTGAGAACACCAATATTA pLKO_005 900 CDS 100% 15.000 10.500 N AGTR1 n/a
4 TRCN0000356695 GCTTGGTGGTGATAGTCATTT pLKO_005 528 CDS 100% 13.200 9.240 N AGTR1 n/a
5 TRCN0000356696 TCACCATTTGTATAGCTTATT pLKO_005 1245 CDS 100% 13.200 9.240 N AGTR1 n/a
6 TRCN0000008095 GCCCTAAAGAAGGCTTATGAA pLKO.1 1049 CDS 100% 5.625 3.938 N AGTR1 n/a
7 TRCN0000008092 CCAGATTGTTCTGTCCAGTTT pLKO.1 1858 3UTR 100% 4.950 3.465 N AGTR1 n/a
8 TRCN0000008094 CCTCAGATAATGTAAGCTCAT pLKO.1 1410 CDS 100% 4.050 2.835 N AGTR1 n/a
9 TRCN0000008096 CCTGGCTATTGTTCACCCAAT pLKO.1 769 CDS 100% 4.050 2.835 N AGTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000685.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05793 pDONR223 100% 99.9% 99.7% None 671A>G n/a
2 ccsbBroad304_05793 pLX_304 0% 99.9% 99.7% V5 671A>G n/a
3 TRCN0000481490 GTACGTACTGTCCCAATTTTTCTA pLX_317 36% 99.9% 99.7% V5 671A>G n/a
4 TRCN0000488503 TGGGCATTACGAGACGGGTCACAC pLX_317 30.4% 99.9% 100% V5 (not translated due to prior stop codon) 573C>T n/a
5 TRCN0000491973 TTTCTTTGGCCCGAGTAGAGATTC pLX_317 35.3% 99.8% 99.7% V5 573C>T;1077_1078insG n/a
6 ccsbBroadEn_05792 pDONR223 100% 99.7% 99.4% None 573C>T;664C>G;1022C>A n/a
7 ccsbBroad304_05792 pLX_304 0% 99.7% 99.4% V5 573C>T;664C>G;1022C>A n/a
8 TRCN0000470780 GTCCGCACCATCAAATTTATTTTA pLX_317 21.8% 99.7% 99.4% V5 573C>T;664C>G;1022C>A n/a
9 TRCN0000488177 AACCGTGTTCTCCGCTCTGCTAGG pLX_317 17.8% 99.7% 99.4% V5 (not translated due to prior stop codon) 573C>T;664C>G;1022C>A n/a
10 TRCN0000489628 CTGGCGGACGACCGGGTCCTGACG pLX_317 38.3% 99.6% 99.1% V5 (many diffs) n/a
Download CSV