Transcript: Mouse NM_177322.3

Mus musculus angiotensin II receptor, type 1a (Agtr1a), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Agtr1a (11607)
Length:
2284
CDS:
371..1450

Additional Resources:

NCBI RefSeq record:
NM_177322.3
NBCI Gene record:
Agtr1a (11607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177322.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027575 GCTCTAAAGAAGGCTTATGAA pLKO.1 1031 CDS 100% 5.625 4.500 N Agtr1a n/a
2 TRCN0000027533 GCCAGTGTCTTTCTTCTAAAT pLKO.1 557 CDS 100% 13.200 9.240 N Agtr1a n/a
3 TRCN0000432986 GTTCAACAGACTGTAGATATT pLKO_005 1571 3UTR 100% 13.200 9.240 N Agtr1a n/a
4 TRCN0000417356 TGTTTGTCCCTTTAGTCATTA pLKO_005 1854 3UTR 100% 13.200 9.240 N Agtr1a n/a
5 TRCN0000027565 CCCTGTTACTACACATACTTT pLKO.1 1894 3UTR 100% 5.625 3.938 N Agtr1a n/a
6 TRCN0000027508 CTAATCATTCTTACCAGCTAT pLKO.1 995 CDS 100% 4.950 3.465 N Agtr1a n/a
7 TRCN0000027582 CCTGTTCCCTTTCCTAATCAT pLKO.1 982 CDS 100% 5.625 3.375 N Agtr1a n/a
8 TRCN0000432464 CATTGAGAACACCAATATCAC pLKO_005 883 CDS 100% 4.950 2.970 N Agtr1a n/a
9 TRCN0000356697 TCATTGAGAACACCAATATTA pLKO_005 882 CDS 100% 15.000 9.000 N AGTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177322.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05793 pDONR223 100% 86.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_05793 pLX_304 0% 86.9% 94.1% V5 (many diffs) n/a
3 TRCN0000481490 GTACGTACTGTCCCAATTTTTCTA pLX_317 36% 86.9% 94.1% V5 (many diffs) n/a
4 TRCN0000488503 TGGGCATTACGAGACGGGTCACAC pLX_317 30.4% 86.9% 94.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491973 TTTCTTTGGCCCGAGTAGAGATTC pLX_317 35.3% 86.8% 94.1% V5 (many diffs) n/a
6 ccsbBroadEn_05792 pDONR223 100% 86.7% 93.8% None (many diffs) n/a
7 ccsbBroad304_05792 pLX_304 0% 86.7% 93.8% V5 (many diffs) n/a
8 TRCN0000470780 GTCCGCACCATCAAATTTATTTTA pLX_317 21.8% 86.7% 93.8% V5 (many diffs) n/a
9 TRCN0000488177 AACCGTGTTCTCCGCTCTGCTAGG pLX_317 17.8% 86.7% 93.8% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489628 CTGGCGGACGACCGGGTCCTGACG pLX_317 38.3% 86.6% 93.6% V5 (many diffs) n/a
Download CSV