Construct: ORF TRCN0000470807
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018414.1_s317c1
- Derived from:
- ccsbBroadEn_15879
- DNA Barcode:
- GATCACCCTATTTGTGTGCCCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPP2R3C (55012)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470807
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | NM_001305155.1 | 100% | 100% | |
| 2 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | NM_001305156.1 | 100% | 100% | |
| 3 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | XM_024449639.1 | 85.5% | 85.5% | 1_174del |
| 4 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | XM_024449638.1 | 81.2% | 81.2% | 1_237del |
| 5 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | NM_017917.3 | 75.7% | 75.7% | 1_330del |
| 6 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | XM_005267782.4 | 75.7% | 75.7% | 1_330del |
| 7 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | XM_017021388.2 | 65.5% | 65.5% | 1_330del;974_975ins138 |
| 8 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | NR_130972.1 | 48.5% | 1_666del;1171_1172ins137;1559_1701del | |
| 9 | human | 55012 | PPP2R3C | protein phosphatase 2 regul... | XR_002957558.1 | 46.4% | 1_793del;1298_1299ins137;1686_1785del | |
| 10 | mouse | 59032 | Ppp2r3c | protein phosphatase 2, regu... | NM_021529.3 | 68.4% | 75.2% | (many diffs) |
| 11 | mouse | 100039815 | Gm2436 | predicted gene 2436 | XM_017315320.1 | 46.3% | 49.5% | (many diffs) |
| 12 | mouse | 100039830 | Gm2446 | predicted gene 2446 | XM_017315322.1 | 46.3% | 49.5% | (many diffs) |
| 13 | mouse | 100039815 | Gm2436 | predicted gene 2436 | XM_017315321.1 | 43.3% | 46.6% | (many diffs) |
| 14 | mouse | 100039830 | Gm2446 | predicted gene 2446 | XM_017315323.1 | 43.3% | 46.6% | (many diffs) |
| 15 | mouse | 59032 | Ppp2r3c | protein phosphatase 2, regu... | XR_381536.2 | 38.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat tggagaggaa gcgatgatca attacgaaaa ctttttgaag gttggtgaaa 121 aggctggagc aaagtgcaag caatttttca cagcaaaagt ctttgctaaa ctccttcata 181 cagattcata tggaagaatt tccatcatgc agttctttaa ttatgtcatg agaaaagttt 241 ggcttcatca aacaagaata ggactcagtt tatatgatgt cgctgggcag gggtaccttc 301 gggaatctga tttagaaaac tacatattgg aacttatccc tacgttgcca caattagatg 361 gtctggaaaa atctttctac tccttttatg tttgtacagc agttaggaag ttcttcttct 421 ttttagatcc tttaagaaca ggaaagataa aaattcaaga tattttagca tgcagcttcc 481 tagatgattt attggagcta agggatgagg aactgtccaa ggagagtcaa gaaacaaatt 541 ggttttctgc tccttctgcc ctaagagttt atggccagta cttgaatctt gataaagatc 601 acaatggCAT GCTCAGTAAA GAAGAACTCT CACGCTATGG AACAGCTACC ATGACCAATG 661 TCTTCTTAGA CCGTGTTTTC CAGGAGTGTC TCACTTATGA TGGAGAAATG GACTATAAGA 721 CCTACTTGGA CTTTGTCCTT GCATTAGAAA ACAGAAAGGA ACCTGCAGCT CTACAATATA 781 TTTTCAAACT GCTTGATATT GAGAACAAAG GATACCTGAA TGTCTTTTCA CTTAATTATT 841 TCTTTAGGGC CATACAGGAA CTAATGAAAA TCCATGGACA AGATCCTGTT TCATTTCAAG 901 ATGTCAAGGA TGAAATCTTT GACATGGTAA AACCAAAGGA TCCTTTGAAA ATCTCTCTTC 961 AGGATTTAAT CAACAGTAAT CAAGGAGACA CAGTAACCAC CATTCTAATC GATTTGAATG 1021 GCTTCTGGAC TTACGAGAAC AGAGAGGCTC TTGTTGCAAA TGACAGTGAA AACTCTGCAG 1081 ACCTTGATGA TACATGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1141 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1201 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GATCACCCTA TTTGTGTGCC 1261 CGTTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt