Transcript: Mouse XM_017315323.1

PREDICTED: Mus musculus predicted gene 2446 (Gm2446), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2446 (100039830)
Length:
1026
CDS:
427..915

Additional Resources:

NCBI RefSeq record:
XM_017315323.1
NBCI Gene record:
Gm2446 (100039830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216144 CATAATGGCATGCTAAGTAAA pLKO.1 418 5UTR 100% 13.200 6.600 Y Ppp2r3c n/a
2 TRCN0000191960 GTCACTACCATTCTAATTGAT pLKO.1 811 CDS 100% 5.625 2.813 Y Ppp2r3c n/a
3 TRCN0000328043 GTCACTACCATTCTAATTGAT pLKO_005 811 CDS 100% 5.625 2.813 Y Ppp2r3c n/a
4 TRCN0000216799 GAGAACTCTGCAGATCTTGAT pLKO.1 886 CDS 100% 4.950 2.475 Y Ppp2r3c n/a
5 TRCN0000201157 GCAACACTGTTGAAGCAGAAT pLKO.1 961 3UTR 100% 4.950 2.475 Y Ppp2r3c n/a
6 TRCN0000055857 GATGAAATCTTTGACATGGTA pLKO.1 727 CDS 100% 3.000 1.500 Y PPP2R3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15879 pDONR223 0% 43.3% 46.6% None (many diffs) n/a
2 ccsbBroad304_15879 pLX_304 0% 43.3% 46.6% V5 (many diffs) n/a
3 TRCN0000470807 GATCACCCTATTTGTGTGCCCGTT pLX_317 47.4% 43.3% 46.6% V5 (many diffs) n/a
4 ccsbBroadEn_08453 pDONR223 100% 32.7% 35% None (many diffs) n/a
5 ccsbBroad304_08453 pLX_304 0% 32.7% 35% V5 (many diffs) n/a
6 TRCN0000465299 CCTTACTATAAAGAACGGAATGAC pLX_317 1.4% 32.7% 35% V5 (many diffs) n/a
Download CSV