Construct: ORF TRCN0000470898
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006591.1_s317c1
- Derived from:
- ccsbBroadEn_05400
- DNA Barcode:
- CAAATGTTCTTCACCTATTCTTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RNF175 (285533)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470898
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285533 | RNF175 | ring finger protein 175 | NM_173662.4 | 99.8% | 99.6% | 965T>A |
| 2 | human | 285533 | RNF175 | ring finger protein 175 | XM_005262938.3 | 89.5% | 89.3% | 764_765ins102;863T>A |
| 3 | human | 285533 | RNF175 | ring finger protein 175 | XM_011531879.2 | 87.8% | 83.8% | (many diffs) |
| 4 | human | 285533 | RNF175 | ring finger protein 175 | XM_011531881.2 | 87.7% | 87.5% | 0_1ins120;845T>A |
| 5 | human | 285533 | RNF175 | ring finger protein 175 | XM_011531882.2 | 79% | 77.7% | (many diffs) |
| 6 | human | 285533 | RNF175 | ring finger protein 175 | XM_011531883.2 | 75.7% | 71.8% | (many diffs) |
| 7 | human | 285533 | RNF175 | ring finger protein 175 | XM_005262939.3 | 75.4% | 74.6% | (many diffs) |
| 8 | human | 285533 | RNF175 | ring finger protein 175 | XM_005262940.4 | 75% | 74.6% | 0_1ins244;3delG;722T>A |
| 9 | human | 285533 | RNF175 | ring finger protein 175 | XM_017008047.1 | 69.7% | 69.2% | 104_105ins297;668T>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1050
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttagcatggc cgcggggacg gcggcgcgga aggcagcgcc ggtgctggag gcccccccgc 121 agcaggagca gctctctcat acaaagcttt ctgcagaaga cacatggaac ctgcagcagg 181 agaggatgta caagatgcac cggggccacg attccatgca cgtggaaatg atcttgatct 241 tcctctgcgt tctggtcatt gcccagatag tgctggttca gtggagacag aggcatggcc 301 gatcctacaa tctggtgacc ttgttgcaga tgtgggttgt ccccttatat ttcacgataa 361 aattatactg gtggcggttt ctgtctatgt gggggatgtt ctccgttatt accagttaca 421 tcctcttcag agctacccga aaacccctct caggaaggac accacgattg gtctacaaat 481 ggtttctttt gatctacaaa ctcagctatg catttggtgt tgtgggttac ttggcgatca 541 tgtttacaat gtgtggattc aatctgtttt tcaaaatcaa agctagagat tccatggatt 601 ttggcattgt gtctttgttc tacggcctct actatggagt aatggggaga gactttgccg 661 agatctgctc agactacatg gcttcCACTA TAGGGTTCTA CAGTGTCAGC CGGTTGCCTA 721 CAAGGAGCTT ATCGGACAAT ATCTGTGCAG TCTGTGGGCA GAAGATCATT GTGGAGCTTG 781 ATGAAGAAGG GCTCATTGAA AACACCTACC AGCTTTCCTG TAATCATGTC TTTCATGAAT 841 TCTGCATCCG AGGTTGGTGT ATCGTTGGGA AAAAGCAGAC TTGCCCTTAC TGCAAAGAGA 901 AAGTTGATTT GAAGAGGATG ATCAGTAATC CCTGGGAGCG CACACATTTT CTGTATGGAC 961 AAATCCTGGA TTGGCTTCGT TATTTGGTGG CCTGGCAACC TGTGGTGATA GGAATAGTTC 1021 AAGGCATTAA CTATTCACTA GGGCTGGAAT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACAAAT 1201 GTTCTTCACC TATTCTTGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt