Transcript: Human XM_011531882.2

PREDICTED: Homo sapiens ring finger protein 175 (RNF175), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF175 (285533)
Length:
2153
CDS:
1122..1904

Additional Resources:

NCBI RefSeq record:
XM_011531882.2
NBCI Gene record:
RNF175 (285533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415194 GTTACTTGGCGATCATGTTTA pLKO_005 1582 CDS 100% 13.200 18.480 N RNF175 n/a
2 TRCN0000007771 CTCCGTTATTACCAGTTACAT pLKO.1 1457 CDS 100% 5.625 7.875 N RNF175 n/a
3 TRCN0000416682 CAAGGAGCTTATCGGACAATA pLKO_005 1777 CDS 100% 13.200 10.560 N RNF175 n/a
4 TRCN0000416543 ACCACGATTGGTCTACAAATG pLKO_005 1517 CDS 100% 10.800 8.640 N RNF175 n/a
5 TRCN0000007769 CGTGGAAATGATCTTGATCTT pLKO.1 1277 CDS 100% 4.950 3.465 N RNF175 n/a
6 TRCN0000007772 GCTTGATGAAGAAGGGCTCAT pLKO.1 1832 CDS 100% 4.050 2.835 N RNF175 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05400 pDONR223 100% 79% 77.7% None (many diffs) n/a
2 ccsbBroad304_05400 pLX_304 0% 79% 77.7% V5 (many diffs) n/a
3 TRCN0000470898 CAAATGTTCTTCACCTATTCTTGC pLX_317 37.3% 79% 77.7% V5 (many diffs) n/a
Download CSV