Transcript: Human XM_011531879.2

PREDICTED: Homo sapiens ring finger protein 175 (RNF175), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF175 (285533)
Length:
1507
CDS:
415..1305

Additional Resources:

NCBI RefSeq record:
XM_011531879.2
NBCI Gene record:
RNF175 (285533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415194 GTTACTTGGCGATCATGTTTA pLKO_005 779 CDS 100% 13.200 18.480 N RNF175 n/a
2 TRCN0000416682 CAAGGAGCTTATCGGACAATA pLKO_005 974 CDS 100% 13.200 10.560 N RNF175 n/a
3 TRCN0000007768 CCTTGGTCCAACATTTAATAT pLKO.1 1346 3UTR 100% 15.000 10.500 N RNF175 n/a
4 TRCN0000007769 CGTGGAAATGATCTTGATCTT pLKO.1 570 CDS 100% 4.950 3.465 N RNF175 n/a
5 TRCN0000007772 GCTTGATGAAGAAGGGCTCAT pLKO.1 1029 CDS 100% 4.050 2.835 N RNF175 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05400 pDONR223 100% 87.8% 83.8% None (many diffs) n/a
2 ccsbBroad304_05400 pLX_304 0% 87.8% 83.8% V5 (many diffs) n/a
3 TRCN0000470898 CAAATGTTCTTCACCTATTCTTGC pLX_317 37.3% 87.8% 83.8% V5 (many diffs) n/a
Download CSV