Construct: ORF TRCN0000470903
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001920.1_s317c1
- Derived from:
- ccsbBroadEn_04578
- DNA Barcode:
- CGTATTGACCCGGATTCTCATTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPSB4 (92369)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470903
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 92369 | SPSB4 | splA/ryanodine receptor dom... | NM_080862.3 | 100% | 100% | |
| 2 | human | 92369 | SPSB4 | splA/ryanodine receptor dom... | XM_017007509.2 | 84.4% | 84.6% | 695_698delAAAA;699_700ins124 |
| 3 | human | 92369 | SPSB4 | splA/ryanodine receptor dom... | XR_924216.3 | 32.7% | 1_215del;910_1028del;1154_2498del | |
| 4 | human | 92369 | SPSB4 | splA/ryanodine receptor dom... | XR_924215.3 | 12.8% | (many diffs) | |
| 5 | mouse | 211949 | Spsb4 | splA/ryanodine receptor dom... | NM_145134.3 | 88% | 97.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 885
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ccagaagctc tcggggagcc tcaagtcagt ggaggtgcga gagccggcgc 121 tgcggccggc caagcgggag ctgcggggtg cagagcccgg gcggccggcg cggctggacc 181 agctgttgga catgccagcg gcggggctgg ctgtgcagct gcggcacgcg tggaaccccg 241 aggaccgctc gctcaacgtc ttcgtcaagg acgacgaccg gctcaccttc caccggcacc 301 ccgtggccca gagcaccgac ggcatccgcg gcaaggtggg ccacgcccgc ggcctgcacg 361 cctggcagat caactggccg gctcggcagc gcggcaccca cgctgtagtt ggtgtggcca 421 cggcccgtgc tcccctgcac tccgtgggct acacggcgct ggtaggcagt gacgccgagt 481 cgtggggctg ggacctgggc cgcagccgcc tctaccacga cggCAAGAAC CAGCCCGGCG 541 TGGCCTACCC GGCCTTTCTG GGGCCCGACG AGGCCTTTGC GCTGCCCGAC TCGCTGCTCG 601 TGGTGCTGGA CATGGATGAG GGCACACTCA GCTTCATCGT GGATGGCCAG TACCTGGGCG 661 TGGCCTTCCG AGGTCTCAAG GGCAAGAAGC TGTACCCGGT GGTGAGTGCC GTGTGGGGCC 721 ACTGTGAAGT CACCATGCGC TACATCAACG GCCTTGACCC CGAGCCCCTG CCACTGATGG 781 ACCTGTGCCG GAGATCCATC CGCTCGGCCC TGGGCCGCCA GCGCCTGCAG GACATCAGCT 841 CCCTGCCCCT GCCTCAGTCT CTCAAAAACT ATCTGCAGTA CCAGTGCCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1021 GAAAGGACGA CGTATTGACC CGGATTCTCA TTTAACGCGT TAAGTCgaca atcaacctct 1081 ggattacaaa atttgtgaaa gatt