Transcript: Mouse NM_145134.3

Mus musculus splA/ryanodine receptor domain and SOCS box containing 4 (Spsb4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Spsb4 (211949)
Length:
2232
CDS:
316..1137

Additional Resources:

NCBI RefSeq record:
NM_145134.3
NBCI Gene record:
Spsb4 (211949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249213 AGCCTTTGCTCTGCCAGATTC pLKO_005 822 CDS 100% 10.800 15.120 N Spsb4 n/a
2 TRCN0000249212 GACTGCAAAGGTGGGTATAAC pLKO_005 1970 3UTR 100% 13.200 9.240 N Spsb4 n/a
3 TRCN0000249215 ACCGCTCCCTCAATGTCTTTG pLKO_005 494 CDS 100% 10.800 7.560 N Spsb4 n/a
4 TRCN0000257847 CTCAAGGGCAAGAAACTATAC pLKO_005 925 CDS 100% 10.800 7.560 N Spsb4 n/a
5 TRCN0000249214 CGAAGTCACCATGCGCTACAT pLKO_005 975 CDS 100% 4.950 3.465 N Spsb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04578 pDONR223 100% 88% 97.8% None (many diffs) n/a
2 ccsbBroad304_04578 pLX_304 0% 88% 97.8% V5 (many diffs) n/a
3 TRCN0000470903 CGTATTGACCCGGATTCTCATTTA pLX_317 44.3% 88% 97.8% V5 (many diffs) n/a
Download CSV