Transcript: Human NM_080862.3

Homo sapiens splA/ryanodine receptor domain and SOCS box containing 4 (SPSB4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SPSB4 (92369)
Length:
2963
CDS:
800..1621

Additional Resources:

NCBI RefSeq record:
NM_080862.3
NBCI Gene record:
SPSB4 (92369)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438028 TCGCTCAACGTCTTCGTCAAG pLKO_005 983 CDS 100% 4.050 5.670 N SPSB4 n/a
2 TRCN0000167420 GCTGTTTATTTATCAGCTTGA pLKO.1 2638 3UTR 100% 4.050 3.240 N SPSB4 n/a
3 TRCN0000167160 CAAGTTTGTTTCCTGTTTCAA pLKO.1 2602 3UTR 100% 5.625 3.938 N SPSB4 n/a
4 TRCN0000166889 CCTCTGAATAATGAATGATGA pLKO.1 2047 3UTR 100% 4.950 3.465 N SPSB4 n/a
5 TRCN0000166913 CTACAAGTTTGTTTCCTGTTT pLKO.1 2599 3UTR 100% 4.950 3.465 N SPSB4 n/a
6 TRCN0000426299 TGAAGTCACCATGCGCTACAT pLKO_005 1459 CDS 100% 4.950 3.465 N SPSB4 n/a
7 TRCN0000441595 TGAGGGCACACTCAGCTTCAT pLKO_005 1351 CDS 100% 4.950 3.465 N SPSB4 n/a
8 TRCN0000418118 ACCAACTTTGGAAACGAAAGG pLKO_005 1770 3UTR 100% 4.050 2.835 N SPSB4 n/a
9 TRCN0000167161 CCACCTCTTATATGTTTCAGA pLKO.1 2777 3UTR 100% 3.000 2.100 N SPSB4 n/a
10 TRCN0000167766 GTGCTGTTTATTTATCAGCTT pLKO.1 2636 3UTR 100% 2.640 1.848 N SPSB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080862.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04578 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04578 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470903 CGTATTGACCCGGATTCTCATTTA pLX_317 44.3% 100% 100% V5 n/a
Download CSV