Construct: ORF TRCN0000470945
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009867.1_s317c1
- Derived from:
- ccsbBroadEn_13622
- DNA Barcode:
- GCAGTGACGCTCTGAGTGCGGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WDR86 (349136)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470945
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 349136 | WDR86 | WD repeat domain 86 | NM_001284262.1 | 100% | 100% | |
| 2 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516148.1 | 70% | 40.4% | 341_404del;809_1062del |
| 3 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516150.1 | 70% | 40.4% | 341_404del;809_1062del |
| 4 | human | 349136 | WDR86 | WD repeat domain 86 | NM_198285.3 | 65.9% | 65.9% | 1_384del |
| 5 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516146.3 | 63.9% | 63.1% | (many diffs) |
| 6 | human | 349136 | WDR86 | WD repeat domain 86 | NM_001284261.2 | 62.8% | 44.9% | 342_343ins136;609_831del |
| 7 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516145.3 | 52.7% | 33.7% | (many diffs) |
| 8 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516144.3 | 52.5% | 31.1% | (many diffs) |
| 9 | human | 349136 | WDR86 | WD repeat domain 86 | XM_005249990.5 | 51.7% | 51.5% | (many diffs) |
| 10 | human | 349136 | WDR86 | WD repeat domain 86 | NM_001284260.2 | 51.4% | 30.3% | 1_384del;725_788del;1193_1446del |
| 11 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516147.3 | 48.5% | 35.8% | (many diffs) |
| 12 | human | 349136 | WDR86 | WD repeat domain 86 | XM_006715966.3 | 47.8% | 44.3% | (many diffs) |
| 13 | human | 349136 | WDR86 | WD repeat domain 86 | XM_005249989.4 | 45% | 32% | 1_384del;726_727ins136;993_1215del |
| 14 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516151.3 | 44% | 36.2% | (many diffs) |
| 15 | human | 349136 | WDR86 | WD repeat domain 86 | XM_011516152.2 | 40.1% | 34.9% | 1_384del;725_788del;927_927delGins266 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 813
- ORF length:
- 744
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcccgggag ttccggggcc accgcaactg cgtgctgacc ctagcctact 121 ctgccccgtg ggacctcccc agcactccct gcgcggagga ggccgcggcc ggggggcttc 181 tggtgaccgg cagcacagat ggcacagcca aggtgtggca ggtggccagc ggctgctgcc 241 accagacgct gcggggccac acgggtgcag tgctgtgcct agtgctagac acgcccggcc 301 acacggcctt cacaggcagc accgacgcca ccatccgtgc ctgggacatc ctgagtgggg 361 agcagctgcg ggtgttccgg gagcaccggg gctccgtcat ctgtctggag ctggtgaacc 421 gactcgtgta ctctggcagc gcggacagga ccgtcaagtg ctggctggca gacacagggg 481 agtgtgtgcg cacgttcacg gcccacagac gcaacgtgag cgccctcaag taccacgcgg 541 gcaccttgtt cacgggcagc ggggacgctt gcgcccgggc cttcgacgcg cagtctggag 601 agctgcggag ggtgttccgg ggccacacat tcatcatcaa ctgcatccag gtgcacggcc 661 aggtgctcTA CACCGCCTCG CACGACGGCG CCCTGCGCCT CTGGGACGTG CGCGGGCTCC 721 GAGGTGCCCC GCGGCCCCCT CCGCCCATGC GCAGCCTCTC GCGGCTCTTC AGCAACAAGG 781 TGGGCTGCGC CGCCGCGCCC CTGCAGCCGG CCTTGCCAAC TTTCTTGTAC AAAGTGGTTG 841 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 901 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC 961 AGTGACGCTC TGAGTGCGGC AGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1021 ttgtgaaaga tt