Transcript: Human XM_011516144.3

PREDICTED: Homo sapiens WD repeat domain 86 (WDR86), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR86 (349136)
Length:
4009
CDS:
304..1710

Additional Resources:

NCBI RefSeq record:
XM_011516144.3
NBCI Gene record:
WDR86 (349136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419099 TGGTGAACCGACTCGTGTACT pLKO_005 1095 CDS 100% 4.950 6.930 N WDR86 n/a
2 TRCN0000122567 CGCTGCACTCACTTTGCATTT pLKO.1 2279 3UTR 100% 10.800 7.560 N LOC401433 n/a
3 TRCN0000434969 CGCTCCTGCAAGGACATGAAA pLKO_005 455 CDS 100% 5.625 3.938 N WDR86 n/a
4 TRCN0000417581 GACACACGTCCATCGTGAACA pLKO_005 587 CDS 100% 4.950 3.465 N WDR86 n/a
5 TRCN0000064193 GCCACACATTCATCATCAACT pLKO.1 1305 CDS 100% 4.950 3.465 N WDR86 n/a
6 TRCN0000064195 GCAGTGCTGTGCCTAGTGCTA pLKO.1 886 CDS 100% 0.880 0.616 N WDR86 n/a
7 TRCN0000064196 CTGCGTGCTGACCCTAGCCTA pLKO.1 717 CDS 100% 0.000 0.000 N WDR86 n/a
8 TRCN0000064194 CTCGCGGCTCTTCAGCAACAA pLKO.1 1441 CDS 100% 1.650 0.990 N WDR86 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13622 pDONR223 100% 52.5% 31.1% None (many diffs) n/a
2 ccsbBroad304_13622 pLX_304 0% 52.5% 31.1% V5 (many diffs) n/a
3 TRCN0000470945 GCAGTGACGCTCTGAGTGCGGCAG pLX_317 20.2% 52.5% 31.1% V5 (many diffs) n/a
Download CSV