Construct: ORF TRCN0000470947
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001345.1_s317c1
- Derived from:
- ccsbBroadEn_13325
- DNA Barcode:
- TTCGCTAATCATTAAAAAAACGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAGS (162417)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470947
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 162417 | NAGS | N-acetylglutamate synthase | XM_011524439.2 | 100% | 100% | |
| 2 | human | 162417 | NAGS | N-acetylglutamate synthase | NM_153006.3 | 68.9% | 68.9% | 1_498del |
| 3 | human | 162417 | NAGS | N-acetylglutamate synthase | XM_011524438.1 | 57.4% | 57.4% | 1_498del;1267_1268ins183 |
| 4 | mouse | 217214 | Nags | N-acetylglutamate synthase | NM_145829.2 | 59.9% | 64.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1173
- ORF length:
- 1104
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggacatgaag ccgctggtgg tcctggggct gccggcccct acggctccct 121 cgggctgtct ttccttctgg gaggccaagg cgcagctggc caagagctgc aaggtgctgg 181 tagacgcgct tcgacacaac gccgccgctg ctgtgccatt ttttggcggc gggtctgtgc 241 tacgcgctgc cgagccggct ccccatgcca gctacggcgg catcgtctcg gtggagacag 301 acctgctgca gtggtgcctg gagtcgggca gcatccccat cctgtgcccc atcggggaga 361 cggccgcgcg ccgctccgtg cttctcgact ccctggaggt gaccgcgtcg ctggccaagg 421 cgctgcggcc caccaaaatc atcttcctca ataacacagg cggcctgcgc gacagcagtc 481 ataaggtcct gagtaacgtg aacctgcccg ccgacctgga cctggtgtgc aacgccgagt 541 gggtgagcac aaaagaacgg cagcagatgc ggctcatcgt ggacgtgctc agccgcctgc 601 cccaccactc ctcggccgtc atcaccgccg ctagcacgct gctcactgag ctctttagca 661 acaaggggtc cgggaccctg ttcaagaacg ccgagcgaat gctacgggtg cgcagcctgg 721 acaagctgga ccagggccgt ctagtggacc tggtcaacgc cagcttcggc aagaagctca 781 gggacgacta cctggcctcg ctgcgcccgc ggctgcactc catctacgtc tccgaggggt 841 acaacgccgc cgccattctg accatggagc ccgtcctggg gggcaccccg tacctggaca 901 aatttgtggt gagctccagc cgccagggcc aaggctccgg ccagatgctg tgggagtgcc 961 tgcggcggga ccttcagaca cttttctggc gctcccGGGT CACCAACCCC ATCAATCCCT 1021 GGTACTTCAA ACACAGTGAT GGCAGCTTCT CCAACAAGCA GTGGATCTTC TTCTGGTTTG 1081 GCCTGGCTGA TATCCGGGAC TCCTATGAGT TGGTCAACCA CGCCAAGGGA CTGCCAGACT 1141 CCTTTCACAA GCCAGCTTCT GACCCAGGCA GCTTGCCAAC TTTCTTGTAC AAAGTGGTTG 1201 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1261 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 1321 CGCTAATCAT TAAAAAAACG GAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1381 ttgtgaaaga tt